I was invited by one of the mods to share this here as a mega thread, so here goes...
Edit - apparently this saga was so long that I had to split it into two parts. This is part 5-8.
​
Well, apparently I need to put this in here. I do not give consent for my posts to be read/interpreted/posted to any monetized or ad-supported platform. Examples include YouTube or other platforms. Short version: If you make money off reading someone else's posts, I do not give consent for you to make money off of my posts.
Part 5:
IRS agents arrived bright and early yesterday morning at the Harpy's house. Including two from the IRS's Criminal Investigation Division.
These are people with arrest power, by the way. And yeah, that's important later in the day.
When I left for work Friday morning, the two IRS-CID agents were walking up to the Harpy's house. I texted my neighbor and friend who lives with a line of sight to her house, and he started sending me updates throughout the day. After the initial pair of agents arrived, another SUV arrived with several more agents. These were apparently there to collect evidence.
Now, I need to briefly back up a few months before the psycho's world started to come crashing down. I had noticed a brand new Mercedes SUV driving around the neighborhood, but really didn't think anything of it. Never paid attention to who was driving it, and really couldn't care. Well, it turns out that before the excrement hit the rotating wind vectoring device, she was living high on the hog, and went out and bought herself a brand new shiny SUV.
Among all of the evidence gathered Friday, they were looking pretty hard at that SUV. According to my friend, several pictures were taken, clipboards consulted, and a lot of looking at the area of the windshield where one would find the VIN.
Around mid-day, the agents that didn't have "Special Agent" on their jackets began hauling out boxes sealed with red tape to their SUV. Several boxes. As well as at least one computer tower, and he thinks a laptop as well.
I thought that my day was made. I really did. But Friday evening, my day got oh-so-much better.
My friend came over and told me he had something to show me.
He pulled out his phone, and gave me an absolute shit-eating grin.
He made me wait for it.
It was worth it.
Dear readers, I got to watch video that my friend shot from his living room window, of the Harpy. Lil' miss President of the Not-Really-an-HOA. Oh, and an absolute bitch to boot, I got to see video of her doing the perp walk.
I got to watch her be marched, obviously ranting and yelling, and stuffed into the back of a Federal Law Enforcement SUV.
Word spread fast through the neighborhood. The scuttlebutt is mostly along the lines of "Interfering with the duties of a Federal Agent". Unsurprisingly, she was released on either bond or recognizance this morning. But she got to spend a night in jail. And she's managed to dig her legal hole just that much deeper.
And there was just one last bit of schadenfreude this afternoon. I was out working in my backyard, and from my yard, I can see the side of her house. So I'm out there, and a flatbed tow truck comes up the street. Didn't think much of it, until I glanced over again, and happen to see it stopped in front of the Harpy's house.
With a county Sheriff's Office cruiser parked there. (Guess they were helping out the IRS).
I say that because that flatbed loaded up that brand new, not even a year old Mercedes SUV. With the Sheriff's deputy standing there the whole time. She was *not* allowed to remove any personal belongings from the SUV. She was not allowed within 10 yards of it, or of the tow truck, or the tow driver. As the driver was turning around to head back out of the neighborhood, I could see that she was on her phone. And clear as day, I heard her ask/shout "WHAT DO YOU MEAN, EVIDENCE!!!"
My house is about half a block from hers. As her shiny SUV was towed away, it drove past my yard. She was watching it drive away, and then saw me in my yard.
I couldn't help myself. I smiled, and waved.
She flipped me off, turned on her heel, and stomped away.
I've had a permanent grin the rest of the day.
PART 6:
Ladies and Gentlemen, this has been one helluva ride. But I think I may have won. Finally.
As of last weekend, the Harpy's house has a "For Sale By Owner" sign in front of it. I wanted to wait and make as comprehensive update as I could. This morning, I got the call I was waiting for from my lawyer (although much more quickly than I was expecting this to all end.).
As I mentioned in the comments in part 5, the Harpy decided to sue me. Tortious interference with business relationship. Tortious interference with contractual relationship. Intentional infliction of emotional harm. Loss of consortium (apparently this whole mess falling down around her ears caused her husband to divorce her). A couple of other things, but those were the high points.
So this psycho decides to sue us for just over $100,000.... Not sure where she came up with that number exactly, but it was enough to cause my eyebrows to raise just a little bit. After my initial panic, I read through the complaint thoroughly. And realized that she had absolutely no evidence. Just a bunch of conjecture and assumption. She was guessing that I was the one who had initially mailed out the letter that revealed the sham HOA. And based the entire lawsuit on that guess. But she had absolutely no proof.
Ok. Lawyering up time. I have a pre-paid legal service through my work, so I got the initial consultation provided by that, and after reading through the actual filings and complaint, my attorney started to laugh, and then got a very malicious look on her face. I told her the entire story, told her about the reddit posts, she read through them and felt that while they could all be tied together into a cohesive picture, that all depended on having some kind of evidence to start with. Assuming the Harpy somehow caught wind of these posts, in her opinion there wasn't enough to even send a subpoena to reddit to get my e-mail address. Not that it would have gotten the Harpy much, since there's not really any obvious link between that particular e-mail address and my actual name. Again, lots of conjecture, but nothing that could be entered into evidence in court.
Why the laughter and then malice? Simple. Our state has a particularly robust "anti-SLAPP" ordinance in place. For those not familiar with the term, "SLAPP" is a "stragetic lawsuit against public participation". You hear about those lawsuits meant to just keep people quiet? Yeah, that's a SLAPP lawsuit. Essentially it's trying to use the legal system to punish you for exercising your free speech rights.
So my attorney explains this to me in great detail. The short version of it is, the way the law is written, Harpy and her attorney now need to prove that this is not a lawsuit that is meant to deter participation in a public venue. This is *really* hard to prove in this case. We're not sure what their plan was , maybe try for a quick settlement or something. I can pretty much guarantee that their plans did *not* include an attorney with a lot of experience in SLAPP litigation. It certainly didn't help that the case was assigned to a judge that my attorney had argued in front of before, and she knew that this judge did not take very kindly to people attempting to weaponize the legal system. I'm not familiar enough with the legal jargon and the finesse of "legalese", but my attorney read through the complaint muttering things like "amateur" and "idiot". It was painfully obvious (at least to her) that this attorney was not exactly... "experienced".
This became all the more evident once we got to our first hearing. We went before the judge in late December, just before the court took a break for the holidays (at least for civil matters - this delayed further proceedings in our case until last week).
During our first hearing, after her attorney (badly) made his opening statement, my attorney got up there. And she absolutely destroyed him. I'm going to have to get a copy of the transcript and study it because some of the verbal judo she used was just a masterpiece. She tore the entirety of their case apart in about 15 minutes. There was absolutely no evidence, there was no way at that point to obtain any evidence to bolster their case, and it is obvious that this lawsuit was the legal equivalent of throwing crap at the wall to see if anything stuck. Then came the coup de grace.
"Your honor, we would like to file a counter suit under [relevant state ordinance]. This is clearly a "SLAPP" suit, based on [multitude of legal citations and references] that is intended to stifle my clients right to free speech under both the [state] constitution as well as the United States Constitution. Even if my client had made all the statements the plaintiff alleges, which we do not admit to, they would be protected speech based on [lots of case citations]. As such, we are serving notice of our intent to seek not only attorney's fees and compensatory damages for my client's time lost from work, but also punitive damages under [multiple case citations]." (This is not an exact quote, I may update it if I get a copy of the court transcripts.)
As soon as she mentioned that specific state ordinance, Harpy's attorney started to look a little nervous. But it was nothing compared to the look on the Harpy's face when my attorney mentioned the counter-suit. Panic probably covers that best.
We were standing outside the courtroom after submitting our discovery request, etc with the court clerk for the counter-suit. We saw the Harpy and her attorney at the far end of the hall, and she was obviously tearing into him, albeit quietly. But you could tell she was *pissed*. She saw me looking at them, grabbed him, and walked away.
At this point, I had expected to wait at least a month, maybe even longer before we got our next hearing. The Harpy's attorney provided the documents we had asked for though, and so my attorney and I went over them one afternoon. At this point, we had not yet set an amount we were countersuing for, but my attorney was saying that about $10,000 was probably what we would end up at provided that they didn't drag the case out and increase the billable hours/lost time figure. We weren't looking to break her, but we wanted at a minimum attorney's fees and my lost work time. That was probably about $4k at that point all together. Add in a few thousand for punitive damages, and we came up to that figure. But after reviewing the discovery documents we realized that Harpy was most likely not only flat broke, but drowning in debt.
Last week, my attorney got a phone call from her attorney. They were looking for a quick settlement. But now it was the other way around. They were hoping we would be content with a quick settlement, and were looking for what it would take to just make this all go away. They realized that with the anti-SLAPP motion we had them over a barrel, and that she had absolutely no proof that I was the one involved anyways. They knew they were hosed, so they had made a request to the judge to dismiss their lawsuit. But because we had hit them with the anti-SLAPP counter, they now had to convince us to drop our suit.
My attorney talked it over with me, and we agreed to let it go strictly at costs incurred. At that point we had gotten up to about $5k. And my attorney wrote the settlement offer in such a way that the Harpy owes the money to the attorney directly, instead of making me pay her and then try to squeeze water from a stone get paid myself. Darn nice of her, I thought. I know I'm probably not going to see the money that's owed me for lost time, but I used vacation time for those days, so I'm not really out the money, just out the accrued vacation time. Would be nice to get some of that back in the form of money, but it's doubtful. Maybe in 10 years that judgement will finally get paid. Who knows.
My attorney called me this morning. The judge approved the settlement. The case was dismissed with prejudice (one of the conditions of our settlement) meaning the Harpy can't ever try to come back at me again for it. Also a no contact order against her. Just for grins... Would love to get her arrested for violating that order, but she's still looking at the potential for time in the greybar hotel for her IRS shenanigans. So that makes me smile a bit.
Now, back to the listing on her home. Since she still has some contacts in the real estate world, even though her home is a for sale by owner, she managed to get it listed in the regional MLS with her as the contact for the "listing agent". The interesting bit about that is that she's very obviously in dire financial straights. Refinances in our county show up as "sales" in the public title history for a home. So looking at when my wife and I refinanced our home, we can see how much the house was "sold" for as the refinance on sites like Zillow. So I looked at the history for her home. She refi'd it around the time of the settlement to the neighborhood for the original fraudulent "HOA" scheme for very close to Zillow's estimate of what the home was worth. So I'm guessing she cashed out most, if not all of her equity in the home to pay for that settlement. The house is currently being listed for about 10% higher than the current Zillow estimate (yeah, I know those are pretty darn unreliable) but the real interesting thing is on the MLS listing, there's a spot where you have to disclose whether it's a short sale or a Bank owned property. And sure 'nuff, under Short Sale? It says "YES".
Let that sink in. She's trying to sell this house for about 10% more than it appears to be worth, and it's *still* less than what she owes the bank..
I think I'll wait until I get home tonight, and then make a quick phone call to the MLS folks and let them know she's no longer a licensed real estate agent and that her listing is a For Sale By Owner.
PART 7 (TAZERS!):
So with the Coronavirus fun and excitement that everyone has been having, most of the courts in our area have slowed way down. Criminal cases are still proceeding in some instances, but not all. Federal courts have been hit or miss, but things have been slowly grinding through. I hadn't really planned on any more updates until the legal proceedings were all wrapped up, but we had some excitement happen a few days ago that I thought this group might appreciate.
We had put a few cameras around our place after a utility trailer was stolen, and they're set up to alert us when they detect motion inside our property line (roughly - the zones start between 2 and 10 feet inside our property line depending on the camera angle). So after getting the kiddos to bed, the Mrs. and I were settling in to watch a little TV when my phone pinged with a motion alert. I pull it up and, sure enough, that sure looks like little Ms. Harpy coming stumbling up our driveway. Camera is in black and white mode since it's after dark, so we can't be sure. So she gets to the front door and that camera has enough light to show color, and sure as hell, it's her. What the hell?
If you remember in part 6, part of the settlement was a no-contact order against this psycho. I ask my wife to go get our copy of the order out of the filing cabinet, grab a pistol and holster out of the safe real quick (licensed, don't worry) and throw it on under my sweatshirt. I don't trust this psycho for one second, and I have no idea what the hell she's doing. I'm on the phone with 911 already, asking them to send the county sheriff since I have a no contact order and the subject of that order is now on my front porch loudly banging on my door.
Now, I admit that I made a mistake here. I did not want her to wake up my girls, so I put the 911 dispatcher on speaker, put the phone in my front pocket, and opened the door. Told her to step off my porch. I should have just left the psycho pounding on the door until the deputies arrived. Thankfully, my mistake did not bite me in the ass. And it did give me a front row seat for the shenanigans that were about to follow.
I'm not sure exactly how much she drank. But she was beyond drunk. She was blasted. She reeked of booze as if she'd been marinating for a couple of days. Maybe longer. And of course, being that drunk, she was loud.
I ask her to step away from my house some more so we can talk. Well, I talk, she yells. Basically what it boiled down to is (translated from drunk) that I ruined her life, that I'm the reason she's losing her house, I'm the reason she's going to jail (she didn't know it, but that was foreshadowing), I'm the reason the IRS is on her, that she lost her marriage, her career, her car, everything. This drunk soliloquy took over 7 minutes according to my cameras. She caps it off with "and maybe I should just kill myself right here right now and maybe you'd be happy with that too!".
Well, crap. I'm now worried that she's got a knife, or some other weapon. I *really* don't want to have to draw on her, or worse. But I'm hearing the deputies coming (they stepped up their response to lights and sirens when she threatened to kill herself). So I know they're close, and I'm trying to verbally de-escalate her. Basically just trying to stall and let them come deal with her. I've backed up several more feet to open distance between us and am just hoping the deputies get here soon. All the time I've got an open line with 911 still on speaker phone.
She continues her drunken rambling until the deputies show up about a minute later, mostly about how it's just "aaaaaaaall my fault". But now her drunk and belligerent escalates up a notch or 5, as she's realized that I must have called the deputies. She starts cussing at me, at them, at life in general. It's a pretty spectacular drunken raving. Kinda made me wish my cameras recorded audio. They are trying to get her attention, they're trying to get her to cooperate with their commands, and I'm backing away from her, telling her to talk to them. Well, pretty quick they realize she's gonna be one of *those* cases. So one of them draws their tazer and starts giving more... Forceful commands.
Well, apparently little miss President of the Not-really-an-HOA really doesn't like being talked to in that tone. Especially not when she's drunk. So she turns to the deputies and starts giving them a piece of her mind. They're ordering her to put her hands up, etc, and she decides that she really wants to get closer to them to yell at them some more.
Two steps.
Two steps, and then I hear the oh so distinctive "POPtactactactactactactactactac" of a tazer being deployed. Stiff as a board, her momentum proceeds to topple her forwards and she faceplants right into my front lawn. Then she's at the bottom of I'd guess a 350+ lb pile of law enforcement and their assorted gear while they cuff her. She's wailing, crying, and I'm just in shock at how crazy this night has gone. Eventually she's stuffed into the back of one of their patrol cars and they come talk to me to figure out just what the hell was going on. By this point my wife has handed me our copy of the no contact order, which I show them and explain (briefly) what all has gone on that has led up to this point.
The deputies go and try to talk to her, but she's just blabbering and crying now. Something else to realize is that with the COVID issues we're having, they're not really taking people to jail for more minor infractions, it's just a citation to appear at such and such date. So I figure they'll take her over But after running her through NCIC/LEDS, turns out that violating the no-contact order puts her in violation of the terms of her bail from when the IRS agents were there gathering evidence.
Whoopsie.
As of yesterday, she was still showing lodged in the county jail (our county has searchable lists of anyone in the jail), and on top of everything else, she's now been charged with violating a no-contact order and her bail has been revoked. Also from what the deputies were saying, on the off chance she is going to be released, since I'm the protected party on the no-contact order, I will be notified.
I do believe she has picked that shovel back up and dug her hole that much deeper.
PART 7b:
Well, someone messaged me asking for an update - I'll keep it brief:
She was released from jail approximately three weeks after this incident. We had a video conference with the judge, and she was not amused by Ms. Harpy's antics. Yes, my video recording of the incident (with the audio from the 911 call) were the prosecutors star witnesses. She made it abundantly clear that if it weren't for the current mess with COVID, she'd have kept Ms. Harpy in the county jail until she went to trial for the various charges. She did strengthen the protective order a bit. It was actually rather hilarious. She asked me exactly how far the Harpy's property line was from ours. A quick look at google maps and we had our answer "75 feet, your honor". The judge then told her that she was to come no closer than 75 feet from our property line in any instance, and that other than when she was at home, she was to maintain 300 feet from us at any given time. The Harpy had the audacity to whine "but that's the route I take to leave the neighborhood!" The judge asked her if there was another way out of the neighborhood. "Yes." "Then I suggest you take that route," the judge replied. It adds about 5 minutes to going anywhere from our area - she has to weave through a lot of residential side streets. Nothing earth-shattering, but certainly annoying.
The house is still listed for sale by owner. Not surprising, since she's asking about 15% higher than similar houses have sold for in our neighborhood. She also has not dropped the price at all. I've seen some serious people in serious looking suits out at her place, so I suspect foreclosure may be coming down the pipe - again once this COVID mess is over.
I haven't heard a peep regarding the federal charges she may be facing. I do know that to say the courts are moving at a glacial pace would be an understatement. I suspect that it may take a year or more for this part to process through. Plus the possibilities of appeals, etc.
Ultimately, I am shocked at how this whole thing has snowballed. All over being bitchy to my wife. I suspect there's a lesson in there somewhere. :)
PART 8 - THE END?:
But first, the obligatory TL;DR:
President of a fake HOA is a bitch to my wife. Gets sued, loses her husband, career, car, and house. She tries to sue me and loses. Decides to get drunk and belligerent, gets tazed. And now is convicted of multiple counts of fraud (misdemeanor and felony) plus a bunch more lawsuits filed.
So a slightly longer summary is that when my wife and I bought our home, we were very specific in avoiding HOA's. After moving in, we met the "president of the HOA" behind our house. AT FIRST, she seemed nice enough, but little did we know the insanity that was going to come out of her. So we hired an arborist to take down a hazardous limb from a tree, and weren't able to move the wood onto our property the day of since he finished late and I was heading out of town the next day. The psychopath decided to freak out on my wife, until she browbeat her into moving these wood rounds (some weighing in excess of 100 lbs) by herself. They were stacked neatly, out of the way, and in no way an impediment to foot traffic. She claimed that the area that the rounds were stacked on was private property of the HOA (turns out it wasn't!) and that it needed to be moved immediately.
Well, some time later, some hedges that were growing on the "HOA's private property" pushed over a section of our wooden fence. E-mailed her, and the short version of her reply was that it wasn't their property and wasn't their hedges so we were SOL on getting our fence fixed by them. Waitwhut?
This kicked off a couple of weeks of calling a multitude of county departments to find out who actually owned that chunk of land. Eventually learn that it is actually county property as part of the right-of-way that was ceded to the county for a road. And the reason it took so long to figure this out was that there *was* no HOA registered with the county. So I sent an anonymous letter to everyone in the "HOA" with what I had found out.
Cue everyone in the fake HOA suing her ass for fraud.
Her husband, who was not in on the scam, promptly files for divorce - he wants absolutely no part in this.
IRS and state revenue agency start crawling up her ass for back taxes.
She was a real estate agent and principal broker. Those licenses were revoked by the state. She loses her job.
House goes up for sale, it's listed for abut 15% higher than comps and it's still a short sale - so she's in deep trouble financially.
She gets arrested for interfering with the duties of a federal agent when the IRS comes knockin - and they seize her brand new Mercedes SUV to boot.
Tries to sue me, loses badly, and has to pay my costs and attorneys fees, and I file for a protective order because she's crazy.
Gets drunk and belligerent, violates protective order. Gets tazed by the county mounties for her troubles. Jail again. Stronger restraining order.
That all brings us to the beginning of this final update....
Due to COVID, courts in my state have been moving at a rather slow pace on civil cases, but criminal cases have resumed... And so recently I had the privilege of sitting in the witness box at our local courthouse, and got to explain to a judge and jury what this insane ride was (I wasn't one of the primary witnesses, I was more for the wrap up of the prosecutor's case. Most of the testimony came from not only her previous victims who lived in the fake HOA, but also other people she has defrauded over the years. It took three days just to get through all of the victims testimony. I was the final witness, and the prosecutor had already gotten the approval of the judge for my testimony, since while some of what I was going to testify to was second hand, it was corroborating the testimony of the actual victims, and really just wrapped the whole case up in a nice neat little package.
So I got to sit there, and tell this whole saga, from start to finish. I don't think the jury even blinked. The defense attorney tried to object a couple of times about hearsay, etc, but he ended up overruled on most of them.
The prosecutor then had to get his last jab in, "So Mr. AmbulanceDriver2, this whole house of cards that she had built up on fraud and deceit, what kicked out the card that caused it to all came down around her?
"What it all boils down to is how she treated my wife that day. Had it not been her assertion of that strip of land being private property, I probably would never have done the digging that I did. But had she not been so rude to my wife, it's probable that I would have just let it go at that, and that I wouldn't have shared my findings with the entire neighborhood."
I wasn't able to be in there for any of the other testimony since it could have tainted my testimony, but in the end she was found guilty of easily a half dozen misdemeanors and at least 10 felonies. I haven't been able to pull up the court records to get an exact count of which were which, but most of those were from new victims she had defrauded since the HOA scam fell apart. There were a couple of more technical violations of the law interspersed (I believe they were specifically relating to shenanigans she pulled as a real estate agent), but fraud is the bulk of what she was convicted of. Sentencing was rather anticlimactic, she got pinged for about 10 years, but talking to the prosecutor about it she will likely serve 5-6 years actually incarcerated.
Her house is in foreclosure. Not sure when the auction is going to happen, but she had already moved out by the time it was officially foreclosed on.
And she's still facing heat on the federal side. No idea what's going to be happening there. I'll probably find out if/when they request that I testify.
I do want to address what some people have said in previous comments. That I'm taking this too far, that I'm taking too much glee in what's happened to her, that I'm a revenge bully. When I sent the letters to the neighborhood, I expected that the fake HOA would be disbanded, and not much more.I was somewhat surprised to hear about lawsuits, and I will admit to a certain degree of schadenfreude at seeing her knocked down a peg or three. But I had no idea how this was going to snowball. It's gotten to the point where I do somewhat feel bad for her. Like maybe I've taken this too far. But I have come to the realization that had she not been scamming people, none of this would have happened to her. While I may have been the one that kicked out the bottom card of that house of cards, I had no idea how massive this was. And so I save my pity for her victims. Most of them probably won't ever get back what they lost to her. Some did, early on. But that's a fraction of her victims. The rest? I highly doubt it. Last time I looked at the court records, she was named as defendant in at least a half a dozen lawsuits. I suspect that number has grown since then.
I guess what it all boils down to is that if you're scamming people, don't piss off your neighbors. you never know what they might dig up.

I was invited by one of the mods to share this here as a mega thread, so here goes...
Edit - apparently this saga was so long that I had to split it into two parts. This is part 1-4.
​
​
Well, apparently I need to put this in here. I do not give consent for my posts to be read/interpreted/posted to any monetized or ad-supported platform. Examples include YouTube or other platforms. Short version: If you make money off reading someone else's posts, I do not give consent for you to make money off of my posts.
​
PART 1:
After years of hearing stories of problems with HOA's (and having no tolerance for busybodies ourselves) my wife and I were both solidly in agreement that we would never purchase a home in an HOA.
When we finally did find a house and purchased it, we knew for a fact that we were NOT in an HOA. However, just behind us, we learned there was a (not really) HOA.
About a week after we moved in, there was a knock on the door. One of the neighbors behind us, announcing that she was President of the HOA, and welcoming us to the neighborhood. Seems civil enough, but we asked, "what HOA".
"Oh, we're behind you, the home behind yours is where the HOA starts."
"Ok, that's nice, nice to meet you..." Just general pleasantries.
We were hopeful. We were shocked, even. Someone associated with the management of an HOA that wasn't a complete busybody psychopath!
How wrong we were.
The way our lot was, there was a sliver of green space between our property line and the sidewalk, in a somewhat triangular shape (the street ran west southwest, our property line ran due east-west). So there was a wedge of land there. We'd always been told that this belonged to the HOA, yadda yadda - no big deal, just meant we didn't have to deal with the upkeep of this land.
Now that this set up is all in place, it's time to start the story of how we got the (not really an) HOA dissolved.
We had a couple of trees in our yard. Literally on the property line, so we took responsibility for taking care of these things. They're *MASSIVE*. They're also a pain in the butt, incredibly dense/heavy, and because of the way the limbs grow, they're prone to splitting and dropping limbs. There was a huge limb that extended way out into the street adjacent to the green space owned by the HOA. This thing was a major risk of dropping and severely injuring/killing someone. We didn't want that on our conscience (or our insurance!) and so we decided to take that limb down entirely, as well as clean out a lot of the deadwood in the two trees. Hired an arborist, they came out, did their thing. $1400 later, we were left with some decent sized rounds that we were going to move over the next weekend (I was out of town the first weekend after we removed the limb). I should not that the wood was neatly stacked in the green space on the barkdust, out of everyone's way, and in no way a hazard or eyesore.
Enter the shrieking harpy...er.. .President of the "HOA". My wife had stepped out the door the day I had left on my trip and she pulls up into our driveway, rolls down the window, and starts yelling at my wife:
"YOU NEED TO MOVE THAT WOOD NOW!!!!! THAT'S PRIVATE PROPERTY OF THE HOA!!! MOVE IT NOW!!!!"
My wife is *not* a confrontational type. She's also somewhat petite, and tried to explain to the harpy that I was out of town and that we would be moving it as soon as I got back in town the next weekend.
Nope, not good enough. She shrieks at my wife some more, and my wife ends up grabbing the wheelbarrow and somehow moves this stack of rounds (some of them weighed close to 100 lbs) around the fence, up our driveway, and into the backyard. She was pissed.
So was I. We knew where the harpy lived, so when I got back I went over to talk to her, and explain that I was rather displeased in how she treated my wife. Didn't pound on the door, wasn't aggressive or anything.
They wouldn't answer the door. Cowards (we knew they were home).
This left us with a bit of a displeased taste in our mouth. The next spring, the hedge that is planted outside of our fenceline, well, it wasn't maintained very well, and pushed over two sections of our wooden fence. So I emailed the harpy and explained that their hedge had damaged our fence.
"It's not our hedge!"
"um... it's growing in your green space"
"That's not our green space!"
Waitwut?
"Then why the [censored] did you decide to screech at my wife last summer when we had the wood stacked there
Silence.
Well, at that point I fixed the fence so our dog wouldn't escape, after pruning the laurel back sufficiently that it wouldn't damage the fence again. And started making some phone calls. I contacted the county, and ended up speaking to about seven different departments in order to figure out who actually owned that strip of land. After probably two weeks of trying to find the right people to talk to, I got to the roads division. The green space was marked as part of the right of way for the road, and therefore no one actually "owned" that space.
"So I can chop down that ugly overgrown hedge that's encroaching on the sidewalk and knocking down my fence?"
"Yep," says the kind gentleman from the roads division.
"As an aside," he asked, "you mentioned something about there being an HOA associated with the plots to the east of your property?"
"Yeah?"
"well, part of what took me so long to get an answer for you is that it turns out there is no HOA registered with the county there, so we were looking in the wrong place entirely......"
"Wait, there's no HOA there?"
"No, hasn't ever been one since that subdivision was built..."
"Huh.... Interesting...."
And a plot was hatched.
We had befriended a couple of people within the neighborhood behind us, and they were rather fed up with Ms. "President of the HOA" and her antics. She was the typical busybody, bullying anyone she didn't like, and apparently for the last 10 years or so had been collecting HOA "dues" from everyone in the neighborhood to the tune of $300/year. There were 36 homes in the "HOA". Right around $100,000 in dues. For a non-existent HOA. With no real maintenance. Oh, they hosted an annual block party - potluck style.... They pulled weeds from the green space - on a volunteer basis.
So I did what any red-blooded American would do. I got 36 envelopes. 36 stamps. And printed off 36 copies of a letter with my findings from the county that there was not now, nor ever had been for the recorded history of the subdivision, any HOA, neighborhood association, or any similar organization. And that they, collectively, had paid in excess of $100,000 in dues over that time to a non-existent entity, plus any fines the non-existent HOA had decided to levy.
The neighbors, in turn, did exactly what any red-blooded American would do.
They sued the hell out of her for every penny they'd paid over the last 10 years.
Won, too.
And there's no longer an "HOA" behind us.
EDIT: Forgot to mention this. In all the digging into this mess, we learned she's a real estate agent. I figure I'll wait until she pisses me off again and report this whole mess to the state's real estate licensing board. *evil grin*\
Edit to the edit: as others have pointed out, this needs to be reported to the licensing board. Will look into that process....
Edit of the edit to the edit: I have sent an initial e-mail to my state's Real Estate licensing board (Real Estate Agency), and will post any updates as things develop. I did look her up in the licensing system, apparently she's licensed as a principal broker for her agency. This should get interesting.
Edit the fourth: And this should be interesting - her license is up for renewal at the end of this month. This should put one hell of a speed bump in that process. *evil grin*
Regarding the criminal charges, since I wasn't a victim of the fraud, that's not something I can pursue. However, I spoke w/ my friend who was one of her victims and he and his wife are talking to other people they trust about coming together and seeking criminal charges.
​
PART 2:
Today, my wife and I had dinner with our friends who were among the victims of this psycho. And I learned a lot. Probably definitely more than I should have. I learned a lot about the lawsuit that was filed when I sent out the letters revealing that there was no HOA. There was, in fact, a settlement to make the lawsuit go away. I will say this, the Harpy got a good lawyer. A *really* good lawyer. One of the terms of the settlement was that the total amount remain undisclosed, but our friends confirmed that they were made whole. Another part of the settlement was a pretty stringent non-disclosure agreement.
I'm gonna have to start pretty far back in this mess, because it explains a lot about how this all went down. The subdivision that Harpy lives in was built back in 2000. And it turns out that at the time the subdivision was built, she was the first one to buy in this brand new neighborhood. The developer had actually planned to set up an HOA (the correct way) but because of delays in construction and selling the homes, they never actually set it up. [Based on one of the comments below and a glance at the relevant state law, this is apparently bad information that was passed on to me.] That didn't stop Ms. Harpy though, not at all. So as soon as the next owners moved in, she reached out to them. "Hi, welcome to the neighborhood. We are setting up a neighborhood association, a voluntary HOA if you will. That way we can take care of the common areas, and keep property values up." The usual excuses behind an HOA.
Well, after the first 5-6 houses were bought and the owners moved in, and agreed to this voluntary "HOA", well... The pitch changed. It went from a "neighborhood association" to just a straight, "Hey, welcome to the neighborhood. I'm the president of the HOA, nice to meet you!" Most people went along with it. They figured they had missed something in the disclosures, or in the listing, or something. But this was a brand spanking new subdivision. And at the time, you couldn't find a brand new subdivision that *didn't* have an HOA. There were a few people that *did* in fact pay attention. When called on it, she would change her pitch back to the "Well, it's not *really* an HOA.... It's more a voluntary neighborhood association... But we do have some rules we've all agreed to (that it turns out she wrote all on her own), and we do collect a small amount of money, just $25 a month, that's not unreasonable, is it? Just to keep up the common areas, and the rules help keep everyone's property values up!"
All of that came to light during the depositions and testimony in this lawsuit.
And she sold them on it. Everyone signed the "rules" (She even called them CC&R's - with the argument that this gave them a certain legal weight to be able to enforce the rules), either under the guise of the "HOA", or the "Neighborhood Association". By the time all the properties were initially sold, it was roughly 2:1, those that thought it was an HOA, and those that thought it was just a voluntary association. And as people sold, and new owners moved in, well, the HOA pitch just got easier to sell. To the point that at the time of the lawsuit, it was somewhere between 3:1 and 4:1.
As testimony was wrapping up, her attorney put forward a proposed settlement. I was able to find out from my neighbor that in this proposed settlement the only people that would be, in the legal jargon, "made whole" were the ones that signed on under the impression that it was a legitimate HOA. Her attorney successfully argued to the judge that the people who signed up under the "voluntary neighborhood association" were not actually defrauded, and therefore couldn't be a part of the settlement. That *really* pissed off those people.
Because of the timing of the whole house of cards tumbling down around her, she had sufficient equity in her house that she was able to refinance her mortgage and pay the settlement amount. So she had to pay a lot of people back out of her own pocket, losing that equity that she had built up over the last ten years. I'm guessing that her husband was *not* in on the scam, as he was not one of the named parties in the suit, and he filed for divorce in the middle of the lawsuit. As for how he didn't know? No clue. Maybe she just had him convinced that her commissions from real estate sales were just that good. I have no idea what the terms of the divorce were, but it was apparently rather acrimonious. Our friends more than once heard shouting matches from the Harpy's house as they were out walking the neighborhood.
So hopefully that clarifies how she was able to sucker people in. Our friends were some of those that were convinced that it was a legitimate HOA, and they told us that she was so smooth, so convincing, that they didn't doubt it for a minute. At least that meant that they were "made whole" even though they couldn't legally disclose how much they got back.
Now, for more recent happenings. One of the things we talked about tonight was our neighbors going to the district attorney and pursuing criminal charges. Well, they talked to the DA's office this morning, and apparently the statute of limitations has passed. For a crime like this, even though it would be a felony level charge, the statute of limitations is only 3 years for that type of crime. BUT I passed on to them the idea of reporting her to the IRS. Since they were among those who lost money, I figure it's only fair that they get the reward if there is one. They both got a rather gleeful look at that idea. So yeah, that should be interesting.
One of the reasons that I said the Harpy got a good lawyer was that one of the terms of the non-disclosure agreement was that if they signed on to the settlement, they agreed not to report her to any professional board or any licensing agency. So she obviously had concerns that something like this might possibly, just maybe, perhaps have an impact on her license as a real estate agent.
Too bad for her that I wasn't part of that settlement. Because after my initial email to the state Real Estate Agency, I got a response back this morning, and after a couple of more e-mails back and forth, I was interviewed over the phone by the head of the professional standards division. They appeared to be *very* interested to hear what I had to say. I gave a recorded statement on the grounds that it would remain confidential (don't want her trying to make my life a living hell). And at dinner tonight, I learned that our friends have a pretty good friendship with several of the people that were *NOT* paid off in the settlement agreement, since they signed up under the "voluntary neighborhood association". The ones her lawyer insisted were not defrauded and therefore couldn't be part of the settlement. Which means they also are not covered under that pesky little non-disclosure agreement.
Before I started writing this update, I e-mailed the names and contact information for three of those owners who still live in the neighborhood to the head of the professional standards division. Because while I had to deal with her craziness and general pain-in-the-assitude, I didn't actually lose any money. But actual victims of her scam? I imagine their testimony will carry quite a bit more weight with professional standards. I also (solely for their convenience) included the state court case number for the lawsuit. Who knows, maybe they can see the records of the lawsuit and the terms of the settlement since they are a state agency.
That, kind Redditors, brings us up to today. If I hear more updates (which hopefully I will through my friends) I will gladly share them here, and I'll happily answer any questions I can.
PART 3:
And now, for Part 3 ladies and gentlemen, a couple of new characters have been introduced. Government agencies have gotten involved.
My friend and neighbor texted me this afternoon, saying only, "CALL ME!!!"
As soon as I was able to, I gave him a call. And he could barely stop chuckling.
He caught me up a bit. After we'd talked the other evening, he'd started talking to some of the people in the neighborhood. And it turns out that Ms. Harpy of the Not-Really-an-HOA is apparently kind of a slow learner. Because in the last couple-three years, while she hasn't tried to bilk anyone else out of their money, some of the newer owners in the neighborhood were being told that there was still a "neighborhood association" and she kept trying to enforce arbitrary rules on people. Except everyone had heard about her antics. And promptly told her to get bent. So if anything, her nonsense has actually created a more cohesive neighborhood. Everyone is united in hating her! :D
But that's not the reason he was chuckling. He was chuckling because he'd just gotten off the phone with an IRS agent. Now normally, that's not your expected reaction when speaking to anyone from the government with the word "Agent" attached to their title in any way. But no. He was chuckling after he spent over an hour on the phone detailing everything he knew about her dealings as "president of the HOA". As well as providing contact info for quite a few others in the neighborhood who knew what had happened over the years. I *really* hope I get to hear more about what happens with the IRS.
As if that wasn't enough good news, I popped over to the state real estate licensing board website (I've been checking it every day since I spoke to the head of professional standards) and saw this:
https://i.imgur.com/4zpahUU.jpg
Sorry I had to redact the hell out of that, but I really want to try to keep this entertaining for you all here while maintaining anonymity.
If I may direct your attention to the section titled "License Information" the column titled "Status"
Additionally, if I may direct your attention to the "Disciplinary Action" section, specifically the columns titled "Resolution" and "Found Issues".
From a little cursory reading of state law and associated regulations, this decision is temporary until the full investigation is completed. Once that happens, the professional standards board will decide if there is to be permanent action against her license. If there is, then there will be a date in the "order signed date" column, and a *really* entertaining link in the "documents" column in the disciplinary action section that lays out the entire case, from start to finish. (I've read a couple of documents in other cases I found where there was a final order - and wow, they lay *EVERYTHING* out).
So there we have it Reddit. I was almost kinda feeling bad for bringing up stuff from years ago to government agencies, but the fact that she is *still* trying to pull off this crap (albeit without the money part) made any of that evaporate like the HOA she thought she had. So it may be the end, or it may not, but at least for now, we've reached the conclusion of the saga of the Harpy of the Not-Really-an-HOA.
PART 4
For those who have read my scribbling on here regarding the Harpy of the Not-Really-An-HOA, hopefully you have enjoyed the saga so far. I am adding this last post on here as a place to put the aftermath of this saga and any updates that I may hear. Because unbelievably, this is a crazy situation that just keeps on giving.
When last we left Ms. Harpy, she was being investigated by the state Real Estate Licensing board, as well as the IRS.
Well, I learned something interesting in this whole saga. Apparently, while the statute for limitations for criminal tax evasion is only three years (or possibly 6 years, depending on the situation), there is apparently no statute of limitations on how far back they can go in civil court. So while she may dodge any federal charges of tax evasion, the IRS will be crawling up in her business however the heck far they want. I suspect that will end.. poorly (and expensively) for her.
Additionally, the state department of revenue has also caught wind of this. Can't imagine how that may have happened. Similar to the feds, while they can't charge her criminally on the tax evasion, I'm sure they also will be digging through all of her tax records for the last, oh, FOREVER.....
I've already had an interview with a rather pleasant IRS agent, and was able to go through everything that I knew, the timeline for what happened, and how it was that I discovered there was not an actual HOA there. When I explained how this all started because she decided to be a bitch about a couple of relatively small issues, and it has since snowballed into, well, THIS, she (the agent) laughed so hard it took us several minutes to get back on track. And she continued to chuckle and giggle throughout the rest of the interview.
And the state department of revenue has contacted me as well, wanting to set up a time for an in person meeting. So that will be fun. :)
I've considered going to the local news media about this as some suggested, but decided against it for a couple of reasons. The story isn't really as fresh as it was 7 or so years ago when it was all going down, and I doubt the news medias ability to keep my name out of it... Maybe not on the air, but somehow it would slip. And that would add needless complication to my life. If somehow she avoids getting her real estate license revoked, maybe that will change the equation enough to where it might be worth letting the media know. Plus it gives them a recent hook to tie the story into. "State Real Estate board refuses to revoke license of crooked agent! News at 11!". You get the gist.
I don't have the screenshot of it, but on the state licensing board website, there's three new items in the "Disciplinary action" section of her license. An additional proposed suspension sanction, and two proposed revocation sanctions. I'm guessing the second proposed suspension is so she can't default back to a "regular" real estate agent. And the proposed revocation sanctions are for her Principal Broker and regular Real Estate agent licenses as well. So that will be interesting to see what happens once it's finalized. I imagine that process will not be quick. Once I get home tonight and have a chance to redact the relevant information from the screenshot, I'll post that as well.
I've heard through my friend who lives in the subdivision that there have been several people contacted by the state Real Estate board, as well as the state department of revenue and the IRS to set up interviews (and some have already been completed).
And just out of curiosity, I checked the website for the local branch of the national real estate company she works for. And lo and behold, she's no longer listed on there as either the principal broker or an agent, and someone else is listed as principal broker. I'm going to take this development as a cautious agency making sure they don't get caught up in any legal messes. But I think someone just learned the lesson, "you are merely a cog in this machine. you are easily replaced."
In a final bit of entertainment for this saga, I was shown several screenshots by my friend of a post in the subdivision's Facebook page that was quite, well, I guess entertaining would be a great word. She's since deleted the post, but essentially she was on there shrieking about how they were "all" under a non-disclosure agreement, and she was apparently threatening to sue any of them that talked to anyone for violation of the NDA. This was met by cricket chirps from anyone who knew what was going on, but there were several "what the hell is she talking about" type of posts by a few of the newer owners who weren't in the know. But my favorite response was by someone who apparently is an attorney (based on how they phrased things) who wasn't here when the not-an-HOA was in effect (she's only lived in the neighborhood for about a year) but apparently caught a quick heads up from somebody. The short version of her post was that while she wasn't aware of the particulars of what was going on, she stated that NDA's don't cover someone answering questions from a regulatory or investigatory agency, either state or federal, as well as not covering any testimony being given under oath. And trying to bully someone into not speaking to such an agency by means of an NDA or otherwise might even be considered witness tampering or intimidation. And a few hours later the Harpy's post (and all the associated replies) mysteriously disappeared... But you know, FB will gladly hand over the whole conversation with a subpoena. And the IRS does not mess around with the possibility of witness tampering. So maybe she might end up facing criminal charges after all. Depends on how stupid she gets, I guess. If past performance is any kind of indicator, she may very well get to spend some time in the gray bar hotel.
And as any more updates come in, I'll add them on as edits to this post so there's one convenient place to watch for updates.
MAJOR UPDATE!!! See the attached photo. The state Real Estate Agency has finalized their orders on her license. Folks, I wish I could share the text of the final orders associated with this action. But because it is public record, it is also searchable, and would all too easily reveal her identity and open the doors to headaches for me and my family. So I'll summarize. The first revocation for Fraud or Dishonest Conduct and Failure to Disclose is of her Principal Broker license. The second revocation, for Incompetence or Untrustworthiness and Records, that's for her regular real estate agent license. There are some bombshells in the final orders. Apparently, as a few people suspected in the comments, there was a lot more happening than just what was happening in her neighborhood. I was shocked at how quickly the final order was released (from what I was seeing in other cases of revocations, the investigation usually lasts anywhere from three to six months). But reading the final orders, the Principal Broker revocation was based mostly on the information in the lawsuit that was filed by the neighbors back in 2012 and the ensuing settlement. However, their investigation apparently turned up quite a bit of other STUFF. Including lying to clients, falsifying records, not disclosing relationship between herself and sellers or buyers, and other instances of outright fraud. I will quote one line nearly verbatim from both final orders... Because it's just so delicious to read:
"While this Board has taken the strongest action granted by the [APPLICABLE STATE STATUTES], much of the information that was discovered during the course of this Board's investigation is beyond the purview of this Board. Therefore we are turning over all records and witness testimony to the [REDACTED] County District Attorney and the [STATE REDACTED] Department of Justice, Criminal Justice Division for further action."
https://imgur.com/qDKNVTg
ANOTHER UPDATE!: Folks the world of legal hurt his woman has brought onto herself just continues to avalanche. This morning, I had walked my daughter to her school bus stop (right on the corner where the not-an-HOA starts) and a unmarked SUV with government plates comes around the corner. Picture every unmarked law enforcement SUV you've seen in a movie. That stereotypical. And they park a couple of doors down from the Harpy's house. I risked being a couple minutes late to work to watch what was about to unfold. And was not in the least bit disappointed. Because out of the vehicle step two individuals wearing dark blue jackets with bright yellow letters. Some very specific letters. BIG letters that may or may not have spelled out "IRS" and underneath in smaller letters the words "Special Agent".
I may have giggled when I got to my truck. I may have laughed uproariously on my drive in to work. Because the first thing I did was look up just how big of a poop-pile she may have landed in. Apparently, a really deep one. Because from what I could find, the only people authorized to wear the "Special Agent" jacket are in the IRS's Criminal Investigation Division.
I texted my friend who lived in the neighborhood this as I was leaving for work around 7:15 this morning.He texted me back around 10ish.... He's been watching all of this unfold out his front window since I texted him. In addition to the original SUV (which is now right in front of her house) there's another SUV there as well. Apparently some other people wearing IRS jackets (just without the "Special Agent") got out of the second SUV, and he just saw them carrying out some "banker's boxes" sealed with red tape, and a couple of computers. And because this poo-pile is not yet deep enough, apparently they were checking something (assuming VIN) on the Mercedes SUV she started driving a few months ago.
I'll update this as he sends me more info. We're seeing the undoing of the Harpy in nearly real-time.... Oh, how sweet it is.
The second post (parts 5-8) can be found here: https://www.reddit.com/NuclearRevenge/comments/kst2vl/how_i_got_a_not_really_an_hoa_disbanded_and/

Catalogue for Previous Weeks - F.A.Q
Song of the Week
This article is far too long to fit within the thread word limit, so it's going to be continued in a child comment which I'll link when it gets there. Furthermore, I've elected to name a few pokemons who technically have niches but too fringe to expand more on. Some of them can be found in previous weeks if appropriate.
RBY
Rhydon and Golem are the most prominent Ground types in the tier, the former with significant more usage stats in the modern metagame. Their shared Rock Ground typing hardwalls Zapdos and, to a much less prominent degree, Jolteon and Moltres. They’re also both countered by Exeggutor, as well as weak to the very popular Blizzard slamming them on their pitiful special bulk.
Rhydon is the significantly more popular of the two. It boasts better bulk, though not to a significant degree. More crucially, it has a 130 base Atk that allows its Earthquake to 2HKO Chansey, 3HKO Slowbro (sometimes), and 3HKO Snorlax. As it threatens these slower bulky mons, it can use many opportunities to set up a Substitute. Rhydon is the only viable user of the move this generation, seeing as it doesn’t block status in gen 1, but Rhydon was already immune to Thunder Wave. It needs to watch out for Sleep Powder & Stun Spore from Exeggutor, however. STAB Rock Slide helps it chase out the fliers which it walls, and the last move slot is reserved for Body Slam, whose only real use is to threaten Paralysis on Starmie or Exeggutor’s switching in. Rhydon can be an incredibly dangerous threat given some Paralysis support, and being immune to Thunder Wave itself is a great characteristic to have.
Golem’s advantages over Rhydon are: speed (which outspeeds nothing more than opposing Rhydons) and Explosion. Its Earthquake misses on very important benchmarks, and therefore it leverages its Explosion, the 2nd strongest move in the game behind Snorlax’s Self-Destruct, to wallbreak for its teammates. While Rhydon can be a late-game sweeper, Golem instead darts in and out of battle to scout for the perfect Explosion timing. OHKO-ing an opposing Tauros can be game-breaking, but it has to be very careful of Gengar or opposing Rock Grounds absorbing it.
Not mentioned: Sandslash
GSC
The ground typing becomes even more prominent in this generation. As Blizzard has been largely phased out, along with the legendary Electrics being on every single team spamming Thunder, every notable Ground types can act as a switch to them.
Nidoking is an excellent offensive threat in the GSC metagame. Aside from STAB EQ, it also learns the famed Ice Beam Thunder(bolt) coverage that allows it to punish many EQ switchins like Zapdos, Skarmory, or Cloyster. While its power without super effective coverage isn’t amazing, only boasting 92/85/85 offensive stats, the move that truly pushes it into great territory is Lovely Kiss. GSC Sleep isn’t as terrible as RBY Sleep, but it’s nevertheless a huge momentum swing. Nidoking therefore can take advantage of this to fire off strong attacks to eventually break through its usual checks given the right opportunity, something no other mixed sweepers can do. If desired, it can also run Thief to steal enemy checks’ Leftovers at the cost of a moveslot.
Steelix is the new evolution of the worthless Onyx, with excellent physical bulk and an auspicious Steel Ground typing. This makes it not weak against the common Hidden Power Ice which the legendary Electrics run, and acts as a near surefire counter to them unless they carry the rarer HP Water. Its base Atk is a pitiful 85, however, and therefore it relies more on Explosion like RBY’s Golem to break walls, but also carry Roar to act as a phaser against things like Mono-lax, Raikou, or Perish Trap Misdreavus. This shuffling also allows its team to rack up more Spikes damage. The last move is often Curse, which allows it to create some offensive pressure with a boost or two, and then abuse Roar even further.
Golem returns with renewed vigor. Having learnt Rapid Spin in a Spike-ridden metagame, Golem found itself as one of the better role compression mons that acts as an Electric check, Rapid Spinner, phaser, and Snorlax check all in one. It still never enters a battle without Explosion, and its poor special bulk means that it must scout enemy Hidden Power lest it becomes a free kill. Nevertheless, Rapid Spin is such an important utility that it sees consistent usage on many teams, so much so that the rare Hidden Power Water from Zapdos or Raikou are mostly aimed to remove it. Unlike other Spinners, Golem matches up poorly against the spiking Cloyster and Forretress, and requires offensive support elsewhere to make sure the hazards stay off.
Marowak boasts the strongest Earthquake in the game. While somewhat gimmicky, its Swords Dance set can give it the maximum 999, and with Spikes support can OHKO nearly the entire metagame at +2. However, this requires serious backup, as Marowak is otherwise painfully slow, frail, and cannot hold Leftovers. Furthermore, help against Skarmory is highly appreciated, as even with 999 Atk, a Rock Slide only 3HKOs the metal bird, who is immune to Spikes and can proceed to phaze Wak out. The 4th moveslot is usually either HP Bug to slam Exeggutor on the switch, or Rest to give it a second chance at sweeping. To get Marowak to work, some support with Agility Baton Pass from Jolteon, or Screens from Blissey is recommended, especially since the latter can Heal Bell off the sleep from Rest.
Rhydon has taken quite a fall in viability since the last generation. With weaknesses to many special attacks, Machamp, and Earthquakes, Rhydon finds itself hard-pressed to accomplish much. Unlike Golem, it provides no utility for the team aside from Roar, and the Snorlax-checking Steelix isn’t weak to Grass, ice, nor 4x weak to Water. Rhydon runs a Curse set to take advantage of its strong 130 Atk and natural physical bulk, as being slower in this generation means your Roar will go first. It cannot get past Skarmory, but can still provide some strong hits to break walls with.
Quagsire’s sole niche is a near fool-proof counter for the legendary Electrics, being immune to their Thunders and not weak to either HP Ice or Water. Its typing makes it a decent mixed wall, as not a lot of pokemons run Grass moves this generation, and can use the free turns its ok bulk generates to set up Belly Drum. EQ and HP Rock makes an ok attacking combo, and Rest can be used for longevity. If unable to set up, however, it’s defensively outclassed by the likes of Miltank or Raikou, and offensively outclassed by Marowak or Snorlax. One must build their team capable of taking advantage of this offensive defensive combination to justify using Quagsire.
Not mentioned: Piloswine, Sandslash, Donphan, Gligar, Nidoqueen
ADV
Zapdos continues to be a prominent threat, and the rise of Tyranitar, Aerodactyl, and general Rock Slide coverage gives Grounds even more viability. Lastly, an immunity to Sand in a tier where Tyranitar is king effectively boosts the longevity of all Ground pokemons, allowing them to actually gain health in Sand with Leftovers.
Swampert is the face of bulky waters in gen 3. It’s one of the most sturdy DD Tyranitar counters there are, resisting Rock unlike its Water-type brethren, and can also act as a catch-all check to many more prominent physical sweepers in the tier like Metagross, Aerodactyl, and DD Salamence. It’s so prominent that it basically forced many, many pokemon to run HP Grass just to have a chance to get past it. As a pokemon itself, however, Swampert can be as defensive or as offensive as one likes, possessing decent mixed offensive stats to complement its STAB EQ and Hydro Pump / Surf, while carrying Ice Beam for many Flying types, especially Salamence, and Grasses, like Celebi. It also has access to the great Focus Punch, which allows it to threaten Snorlax and Blissey while OHKO-ing max HP Tyranitar, something its Hydro Pump cannot do. Toxic, Roar, Protect, Refresh are all excellent moves for a more defensive variant. No matter what set it’s running, Swampert’s role in ADV OU cannot be understated, and is therefore one of the most common offensive / defensive threats of the metagame.
Dugtrio has gained Arena Trap this generation, and becomes one of the best revenge killers of the metagame. While it’s not very strong, the introduction of Choice Band gives it the power to achieve crucial KOs, and its amazing base 120 Spe means it can outrun basically any threat it encounters. The list of its victims is vast: Tyranitar, Metagross, Jirachi, Blissey, Celebi, opposing Dugtrio, Breloom, and many, many more. It’s undoubtedly a metagame defining threat, as something like Jolteon is considered superior to the legendary Raikou by many simply due to its Dugtrio-beating speed and access to Baton Pass to escape trapping. It’s also a very important team member of special offence, an almost required piece that exists solely to reliably remove Blissey, sometimes by the otherwise unseen Beat Up.
Claydol is the Rapid Spinning Ground type of ADV. Its unique Ground Psychic typing along with Levitate means it resists all of Ground, Fighting, Electric, and Rock, and is immune to Spikes and Dugtrio’s Arena Trap. All of this means that Claydol finds many opportunities to switch in and get off a spin against many common attacks like Rock Slide, EQ, Thunderbolt etc. It also possesses a STAB Psychic to threaten out the most common spinblocker of the tier: Gengar. Finally, Explosion gives it utility as a wallbreaker, especially if running Adamant to threaten out most of the Explosion-resistant pokemon with Earthquake. However, its support requires teammates’ help against Skarmory, as it can’t meaningfully threaten the metal bird, who often forces the issue with Drill Peck.
Flygon is last. Its Ground Dragon typing and Levitate means it’s also resistant to QuakeSlide and Spikes, while also not being weak to HP Bug from DD TTar or HP Grass aimed at a teammate’s Swampert. While its 100/80/100 offensive stats won’t be winning awards, STAB EQ and a myriad of offensive options almost guarantees it’ll find a target to hit, and its defensive profile is excellent for finding chances to enter the field. It can even run a more defensive Protect Toxic set that abuses its defensive capabilities to spread status and break down many teams late-game.
Not mentioned: Gligar, Steelix, Donphan, Marowak, Camerupt, Rhydon
DPP
Stealth Rocks (SR) was introduced in this generation and became the most influential move in the metagame. Coincidentally, Ground types get them.
Swampert returns once again as the premier bulky water. With Tyranitar as popular as ever with physical Pursuit, Superpower, and STAB Stone Edge, Swampert’s defensive capabilities are called into need once again. That said, the physical special split also gave it access to physical water STAB in Waterfall and special Ground STAB in Earth Power, along with extra Ice Punch and Superpower coverage for the physical side. The most popular sets feature SR in some way, to guarantee Pert value as either a lead or a role player, either with max Atk for more damage, or mixed defence to be more of a tank. In this capacity, physical coverage is far more popular. If even more offence is desired, a bulky Choice Band set that runs Stone Edge for Zapdos and Gyarados can do a bit of wallbreaking, or even Modest special set with Hydro Pump spamming. However, these more offensive options remain unpopular compared to the utility set.
Gliscor features an excellent Ground Flying typing that gives it only 2 weaknesses, a SR neutrality but a Spikes immunity, and resistant to the new Close Combat and Superpower. 75/125/75 defences make for an excellent physical defensive profile, and 95/95 offensive stats are surprisingly decent for a mon with such great bulk. Its Stallbreaker set is its most popular, running Taunt to shut down recovery attempts on walls while also preventing offensive mons from setting up on it, and Roost for reliable recovery. If some offensive power is needed, it can run a Swords Dance set to abuse its natural bulk to gain multiple boosts due to its incredible staying power. Its attacks usually consisted of the mandatory STAB EQ, Ice Fang for Flyings, Dragons, and the occasional grasses, and perhaps Thunder Fang for bulky waters or Wing Attack for Breloom. Taunt and SR also make Gliscor a decent lead, as it can U-Turn out to keep momentum.
Flygon appreciated the generational shift very much. It gained an excellent physical dragon STAB in Outrage, and U-Turn allows it to run a very effective Choice Scarf set to utilise its good speed and great neutral coverage in just Outrage and Earthquake. Its last slot on a Scarf set can therefore be very flexible, either Thunder Punch for Gyarados, Dragon Claw for more stable STAB, or Toxic to cripple a wall. The new Life Orb also synergises well with its mixed move pool, allowing it to drop powerful Draco Meteor while still running Earthquake and Fire Blast to crush the Steels that resist its Dragon STAB. Roost can be used on this set to offset Life Orb recoil and give Flygon more general longevity, but if Expert Belt is run instead, U-Turn is always an excellent option.
Nidoqueen, despite its NU placement, is an excellent OU Stall machine. Its claim to fame is the new Toxic Spikes, and on stall teams the Poison Ground typing provide resistant to Fighting and Rock, which couples with 90/87/85 mixed bulk to check the likes of Breloom, Lucario, and Tyranitar, especially since EQ as a coverage move is rarely ran, and Poison Point can punish a lot of the U-Turn spammers in the tier. A lack of recovery does hurt, and thus Nidoqueen prefers Protect to get as much recovery out of Black Sludge as possible. While Nidoqueen’s offences aren’t anything special, its vast movepool means that its moveset can be specifically tailored to cover the threats which the rest of its team does not.
Hippowdon is the alternate Sand setter of the tier. While most prefer Tyranitar’s offensive prowess, Hippo itself is a near sure-fire Tyranitar counter, boasting a titanic physical bulk of 108/118 that can sit on most of the physical threats of the metagame. It complements this by excellent recovery in Slack Off, and SR which allows Hippo to always get pressure out of the switch. Roar synergises with this even more, racking up damage on the pesky flying types or Levitate-rs that otherwise walls it. If a more direct option is preferred, Ice Fang can slam the Gliscor and Dragons. Still, since it relies on pure bulk more than resistances to wall physical threats, it’s usually very specially frail, and has a weakness against some physical threats in Gyarados and Breloom.
Mamoswine boasts a meaty 130 Atk stat, and a unique STAB combination of Ground and Ice. Its Ice Shard is an excellent priority move which knocks the life out of dangerous threats like Latias, Flygon, and Gliscor, its STAB EQ crushes most neutral targets, and for everything else, there’s Stone Edge. Life Orb is the most popular item, allowing it to switch moves and especially abuse Ice Shard to finish off faster threats should the opportunity arise. While Superpower is a fine 4th move to slam Steels not weak to EQ like Bronzong or Skarmory, and OHKO Blissey without a second thought, Stealth Rocks can be used here to exert some pressure as the opponent switches out. Choice Band is an alternative, but locking into any of those four moves can be exploited heavily. Focus Sash makes Mamo a decent SR lead as well. Despite all this, its typing gives it a lot of common weaknesses, and 80 speed isn’t nearly as good as it used to be.
Quagsire lived under Swampert’s shadow in gen 3, but access to reliable recovery in Recover as well as Encore to counter setup sweepers gave it a niche this generation. As Swampert’s more often than not opt for offence this generation, Quagsire is a fine defensive Water Ground type that walls Starmie (with Water Absorb), Metagross, or Tyranitar. Its moveset is very predictable, however, as after the prerequisite Earthquake, the last move is either Toxic for more residual damage or Ice Punch for Flygon or Dragonite. Quagsire is extremely predictable, and must be used with consideration.
Gastrodon is yet another Water Ground type. While it isn’t immune to Water, and therefore doesn’t counter Starmie or Gyarados, it has Sticky Hold which makes it immune to Trick from a lot of choice-d pokemons. Its sole unique role is therefore as a Curse sweeper that’s immune to Trick, who sports good mixed bulk and Recover for longevity. Waterfall + Earthquake a.l.a Swampert is good enough coverage, but it’ll struggle to beat the likes of Gyarados or Latias with such limited coverage.
Rhyperior is a fierce wallbreaker, as 140 base Atk is nothing to scoff at, and its attacking options ranging from STAB EQ + Stone Edge to coverage in Aqua Tail, Megahorn, or Fire Punch are all excellent options. However, it’s really, really slow, and therefore easily forced out with its double 4x weaknesses and poor special bulk, even with Solid Rock or Sandstorm SpD boost to soften them. Choice Band is by far the most powerful option, boasting the ability to 2HKOs everything in the metagame with the right coverage. However, it doesn’t have a lot of opportunities to fire off this power due to its speed and poor matchup against the bulky waters of DPP like Swampert or Milotic.
Donphan gained SR and Ice Shard this generation. It’s now a fairly respectable Rapid Spinner in the metagame with excellent physical bulk and priority. For the most part, it’s a fine support pokemon that aims to set up SR, takes a few physical hits, and threatens revenge kills against Dragons with Ice Shard. It’s a very one dimensional pokemon in this aspect, but its effectiveness as a Rapid Spinner is appreciated.
Not mentioned: Dugtrio (R.I.P), Steelix, Nidoking, Camerupt, Gastrodon
BW
Landorus-Therian is a name one should not fail to keep in mind. It has Gliscor’s auspicious typing, combined with an excellent ability in Intimidate, fearsome 145/105/91 mixed offensive stats, and a respectable 89/90/80 bulk if kept in mind its typing and ability. Lando-T is is one of the best pokemon of gen 5 OU, and is one of the best glues for any good non-rain team. Its Choice Scarf set is an excellent scout and revenge-killer, with a strong U-Turn to punish the like of Latios. Lando-T is in fact so common that it also runs HP Ice for the mirror matchup, despite it not hitting too many other relevant targets. Earthquake is its STAB move of choice, but any other move can be slotted in and out depending on sets. Stone Edge is a natural pairing on the Scarf set, but Superpower is a fine option to drop Skarmory, Ferrothorn, or Air Balloon Heatran. If an offensive pivot is desired, just drop the Scarf and speed for a bulky spread and either Leftovers or Rocky Helmet, and you have one of the best physical checks of the metagame against the dangerous Terrakion. Lastly, access to either Swords Dance, Rock Polish, or even both on the same set can turn Lando-T into a fearsome sweeper at the drop of a hat.
Excadrill is another gen 5 addition, and after a tumultuous history of ban and unban, it settles into the metagame as the best non-rain Rapid Spinner, a.l.a old Donphan. However, it instead boasts Steelix’s typing and a 135 base Atk, making sure that Jellicient cannot simply switch into its Spin with impunity in fear of eating a STAB Earthquake. Its most common set is an offensive spread but with Leftovers and Protect for longevity, befitting of a Rapid Spinner. Unlike most other Grounds, it prefers STAB Iron Head to Rock coverage, as the former hit Latios harder, and can help it beat Breloom. As a Spinner, it can either lean into an offensive spread with STABs, or a more defensive SpD spread that prioritises its laundry list of resistances, especially to Dragon, for better longevity. Though Sand Rush is banned, a Scarf set works perfectly fine to revenge kill, or get up a desperate fast Rapid Spin before falling. Sand Force comes in nicely here, as Exca runs all 3 types of moves that get the boost in its STABs + Rock Slide.
Garchomp dropped to OU this generation, but perhaps that was the chance it needed to flex its power on the metagame. While it’s never seen without its trusty Earthquake, the sheer breadth of sets this pokemon can and does run boggles the mind. The most popular is a very straightforward Choice Scarf set to elevate a great 102 base Spe, and would be great even with just 2 moves in Outrage and Earthquake. It can afford to run Dual Chop for Sash Zam or Multiscale Dragonite, or just straight up Dragon Claw as a more reliable 3rd move. The last move on a scarf set is usually a fire coverage, either Fire Fang or Fire Blast, to roast the likes of Skarmory, Bronzong, or Ferrothorn. As a sweeper, Garchomp leverages its forced switches well with a Substitute Swords Dance set that uses Salac Berry to boost its Spe past most opposing Scarf revenge killers, as its sheer STAB combination is so good on its own. If desired, one can run just an offensive Stealth Rocks set like other Ground types, but Garchomp’s Rough Skin means it has extra synergy with Rocky Helmet that really punishes U-Turn while being simultaneously immune to Volt Switch.
Gliscor gains the excellent Poison Heal this generation, giving it amazing passive recovery and immunity to statuses. For the most part, it uses its typing and access to reliable recovery to spread Toxic with Substitute, while having STAB Earthquake to slam the Steels and Poisons immune to the status. Being always poisoned means that it now has access to Facade as a really strong neutral move to complement its EQ, and thus the Swords Dance Roost set yet see a healthy amount of usage. While Gliscor can’t get past Skarmory at all, its general positioning against the rest of the physical metagame means it will probably always have value in a team, especially if running Taunt. As with all Ground types this generation, it can run a support Stealth Rocks set as well that spread statuses in the meantime.
Mamoswine is once again an excellent offensive threat. Having learnt Icicle Crash as a strong STAB Ice attack this generation, its general offensive coverage with just its STABs is very notable. As DragMag becomes a legitimate offensive force in the metagame, Mamoswine can be found with or against them, leverage Ice Shard to shut down the Salamence, Dragonite, or Garchomps one can find on those teams. Superpower is a great general coverage move to slam Ferrothorn and Kyurem-B with, and Stealth Rocks is always an option that goes well with priority and a Focus Sash.
Gastrodon gained a water immunity this generation, and has propelled into stardom as an anti-rain wall. Its distinction comes from being a Keldeo check that isn’t weak to Pursuit, unlike Jellicient and Latios, and instead spreads status of its own with Toxic and the ridiculous Scald. It also stops Thundurus-T cold, something many other Keldeo checks cannot claim. Physically defensive is the most common spread to fulfil this niche, and with proper support from the rest of its teammates to cover its vulnerability to Toxic and Grass types, Gastrodon is a stalwart defensive answer to many of the metagame’s biggest threats.
Seismitoad is Gastrodon but with Stealth Rocks, in essence. It does everything else Gastrodon does a little worse due to its poorer bulk and no access to Recover, but the role compression can be highly desirable on more offensive teams who prioritise the momentum that hazards give, rather than a long-term wall like Gastro is.
Hippowdon once again plays second fiddle to Tyranitar as a physically defensive Sand setter. Reliable recovery means it can act as a check to many strong physical threats and prevent their setting up with Whirlwind, while setting up Stealth Rocks of its own. Its poor special bulk and weakness to Rain spam means that it might not always put it as much work as it wants to against opposing Rain, but if you want your Sand setter to also be a physical wall, Hippo’s the one for the job.
Not mentioned: Dugtrio (R.I.P), Golurk, Nidoking, Nidoqueen
Continued here in a comment

Introduction

Mission datasheet

Hi, I'm u/Nsooo and I am going to bring you live coverage of SpaceX's last launch for 2020. 🚀

Your host team

Reddit username	Twitter account	Responsibilities	Currently hosting?
u/hitura-nobad	@HituraNobad	Launch thread take 1	⭕
u/Nsooo	@TheRealNsooo	Launch thread take 2	✔️

Watching the mission live

Link	Note	Currently On Air?
SpaceX Hosted Webcast	starting ~15 minutes before launch	✔️

About the mission

SpaceX will launch an undisclosed payload into orbit for the National Reconnaissance Office aboard a Falcon 9. This launch was only recently confirmed by the NRO, and little is known about the mission except that the booster will return to land at Cape Canaveral.

Official mission overview

SpaceX is now targeting Saturday, December 19 for launch of the NROL-108 mission from Launch Complex 39A (LC-39A) at Kennedy Space Center, Florida. Saturday’s three-hour launch window opens at 9:00 a.m. EST, or 14:00 UTC, and closes at 12:00 p.m. EST, or 17:00 UTC. Falcon 9’s first stage booster previously supported launch of SpaceX’s 19th and 20th cargo resupply missions to the International Space Station, a Starlink mission, and the SAOCOM 1B mission. Following stage separation, SpaceX will land Falcon 9’s first stage on Landing Zone 1 at Cape Canaveral Space Force Station in Florida. ->Expected event timeline
Source: SpaceX

Vehicles used

Type	Name	Location
First stage	Falcon 9 v1.2 - Block 5 (Full Thrust) - B1059	KSC LC-39A
Second stage	Falcon 9 v1.2 - Block 5 (Full Thrust)	KSC LC-39A
Fairing recovery	GO Searcher	Atlantic Ocean
Fairing recovery	Ms Tree	Atlantic Ocean

Core data source: Core wiki by SpaceX
Ship data source: SpaceXFleet by u/Gavalar_

Timeline

Time	Update
	This concludes our coverage too here at SpaceX. I was u/Nsooo, thank you for joining, have a nice day!
	Confirmation from the GNC engineer that payload is on good orbit.
T+00:08:15	Falcon 9 has landed!
T+00:06:23	Entry burn.
T+00:02:42	Fairing deployment.
T+00:02:35	Stage 1 boostback burn.
T+00:02:18	Main engine cutoff (MECO). Stage separation. Second stage ignition.
T+00:01:12	Max-Q, maximum dynamic pressure on the vehicle.
T+00:00:20	Nominal propulsion and trajectory.
T+00:00:00	Liftoff! Falcon 9 has cleared the tower.
T-00:01:00	Falcon 9 is in startup.
T-00:03:00	TE is in 88.9 degrees.
T-00:07:00	Engine chill.
T-00:11:30	In case we get any info about the mission after the webcast ended, we will update the thread.
T-00:13:00	Webcast will conclude after S1 landing, and no S2 views per customer request.
T-00:14:00	Countdown proceeds smooth, SpaceX teams tracking no issues.
T-00:20:00	♫♫ SpaceX FM has started  ♫♫
T-00:35:00	RP-1 and LOX loading has begun.
T-00:38:00	LD is GO for propellant loading.
T-01:30:00	SpaceX is GO for launch.
T-02:00:00	Hi! Im u/Nsooo and I am going to host today's launch attempt of NROL-108 mission.

Payload's destination orbit

Which orbit could this secret satellite be potentially launching to?
Based on hazard zones, it is likely that NROL-108 will be launching into an inclined orbit somewhere in the range of 52°. The orbital altitude is expected to be less than 1000 km, but it could potentially end up in a high elliptical orbit or something else too, as we have no idea what this payload will be doing.

Falcon 9 first stage's assigned place of landing

Location 📍	Downrange distance 📏	Coordinates 🌐	Sunrise 🌅	Sunset 🌇	Time Zone ⌚
LZ-1, CCSFS 🌍	~11 km	28 N 80 W	07:09	17:30	UTC-5

Lot of facts

☑️ This will be the 26th SpaceX launch this year.
☑️ This will be the 103rd Falcon 9 launch.
☑️ This will be the 5th journey to space of the Falcon 9 first stage B1058.
☑️ This will be the 1st national security payload flying on a reused booster.

Launch related Informations

Schedule

Time 🚦	Time zone 🌎	Day 📅	Date 📆	Time ⏱️
Primary launch window 🚀	UTC	Saturday	December 19	14:00-17:00
Primary launch window 🚀	EST	Saturday	December 19	09:00-12:00

Scrub counter

Scrub date	Cause	Countdown stopped	Backup date
December 17	Technical (⚙️) - S2 LOX high pressure	T-00:01:53	December 19

Weather - Kennedy Space Center, Florida

Launch window	Weather	Temperature	Prob. of rain	Prob. of weather scrub	Main concern
Primary	🌤️ mostly sunny	🌡️ 13°C - 56°F	💧 5%	🛑 10%	Cumulus rule (☁️)

Source: www.weather.com & 45th Space Wing

Useful Resources, Data, ♫, & FAQ

Essentials

Link	Source
SpaceX	SpaceX
Official press kit	SpaceX

Social media

Link	Source
Subreddit Twitter	SpaceX
SpaceX Twitter	SpaceX
SpaceX Flickr	SpaceX
Elon Musk's Twitter	SpaceX

Media & music

Link	Source
TSS Spotify	u/testshotstarfish
♫♫ Nsooo's favourite ♫♫	u/testshotstarfish
SpaceX FM	u/lru

Launch viewing & hazard area resource

Link	Source
Watching a launch	SpaceX Wiki
Detailed launch maps	@Raul74Cz
Launch Hazard Maps	45th Space Wing

Community content

Link	Source
Watching a Launch	SpaceX Wiki
SpaceX Fleet Status	SpaceX Fleet
Launch Maps	u/Raul74Cz
Flight Club live	u/TheVehicleDestroyer
SpaceX Stats	SpaceX
Discord SpaceX lobby	u/SwGustav
Rocket Watch	u/MarcysVonEylau
Reddit-Stream	njr123
SpaceX Time Machine	u/DUKE546

Participate in the discussion!

🥳 Launch threads are party threads, we relax the rules here. However, we remove low effort comments in other threads!
🔄 Please post small launch updates, discussions, and questions here, rather than as a separate post. Thanks!
💬 Please leave a comment if you discover any mistakes, or have any information.
✉️ Please send links in a private message; if you send them via a comment, there is a large chance we will miss them!
✅ Apply to host launch threads! Drop us (or u/hitura-nobad) a modmail if you are interested. I need a launch off.

This video attempts to explain why one should believe the things the christian bible says, specifically because:

it's a reliable collection of historical documents written by eyewitnesses, during the lifetime of other eyewitnesses. They report supernatural events that took place in fulfillment of specific prophesies, and claim that their writings are divine rather than human in origin.

THESIS: The arguments and evidence presented in the video completely fail to support the above position.
It's a huge post: feel free to only tackle a specific section or 2, I think they're mostly self-contained.
In some cases I say that I suspect the speaker of being dishonest. If you don't like that, just know that he straight up calls people "ignorant, or evil, or both" [34:07] and "fools" [56:03] (stated as a fact, not merely his opinion) for using specific arguments or not accepting his conclusion. I think he opened up the Pandora's Box of guessing others' intent and so I've done it as well, though I've tried to be as responsible as possible. If you think I've been unfair, please let me know why.
TL;DR and conclusion next, for your convenience...

TL;DR & Conclusion

The speaker first presents the question: "why the bible?" (I've tried to phrase this more rigorously as: "why should anybody consider the bible authoritative on the truth of the Universe?") The speaker then presents his answer, and dissects it to address and support each claim within it.
However, his methodology for investigating the question actually rests on the premise that "there is no higher authority than the bible" (in his own words, 12:35-ish). This is a direct answer to the question he's investigating, and therefore any answer which rests on this premise is circular. I demonstrate that important portions of the speaker's argument do seem to rest on this premise and other lines of fallacious reasoning, and so his answer seems to be based on invalid reasoning and should not be trusted.
The speaker also fails to present compelling evidence for any of the claims which make up his answer, and often relies on fallacious arguments. His arguments include:

• Questionable interpretations of biblical passages: citing passages widely believed to be forgeries as if they are eyewitness testimony, and reading "between the lines" and other forms of motivated interpretation
• Unsound interpretations of the history of the bible: preferring a "very early" authorship of New Testament books, against the consensus of modern scholars and without giving any justification; and citing absence of evidence as evidence of absence (argument from silence), in a case where the old adage actually holds true
• Errors in analyzing probabilities: preferring less likely explanations over more likely ones, or not applying Occam's Razor where it would help
• Straw men, an appeal to consequences, an argument from popularity, affirming the consequent, and other fallacious arguments

Even ignoring the circularity of his methodology, the speaker fails to come close to proving his point. That's not to say he's wrong: the bible could be an authoritative source of information about the Universe, and he's just failed to piece together a valid argument which supports that position. I don't think that's the case (and I've done just a bit to rebut that position), but it's possible. However, after viewing this video and considering all the poor arguments it presents, I still think it's far more likely that christianity and its bible originated entirely due to mundane natural events, maybe akin to what's proposed here.
In my own experience, however flawed the arguments presented in this video are, I've seen them used a lot. I hope that some readers might see how to debunk an argument they consider sound, so that those folks can reconsider their position and build stronger arguments in the future.

Video Overview

First off, this video attempts to answer the question "why the bible?" In the context of the video it's pretty clear what he means, but it's vague out of context, so I'll rephrase it more rigorously:
"Why should anybody consider the bible authoritative on the truth of the Universe?"
For the most part the video is a systematic dissection of the speaker's position.

The "Egregious Flaw" in Methodology

At [12:35] the speaker says the following, to rebut the objection that 'proving the bible using the bible constitutes circular reasoning'. He's trying to get in front of this objection because most of his reasoning is, in fact, an attempt to prove the bible using the bible.

The question is "why I choose to believe the bible". ... The answer to that question for me resides in the bible itself. Now why would I appeal to the bible in this way? Because there is no higher authority than the bible. See, if I were to appeal to another authority, then I would be conceding that there is a higher authority than the bible. So this might be a problem in any other area, and any other field -- however, I'm making the argument that this is the higher authority, and therefore by definition I cannot appeal to another authority.

He asks the question "why do I consider the bible authoritative?", and he investigates it under the premise that "there is no higher authority than the bible". The main premise underlying his entire investigation is a direct answer to the question he's investigating: this is the definition of circular reasoning.
​
But doesn't he make a good point? Wouldn't any other premise corrupt his investigation and bar him from reaching the conclusion that "there is no higher authority than the bible"?
No, that's ridiculous, and here's why...
For one thing, when the speaker says that his question is different from any other question in any other field, and yet fails to give a sufficient explanation for how it's different -- that's special pleading. Sure, maybe it's impossible to investigate whether any given thing is the ultimate authority. But even if that's the case, it doesn't make circular arguments valid.
Including an answer as a premise forces one to interpret all the evidence in a manner consistent with the premise, or to only consider evidence that's consistent with the premise -- which of course forces the investigation to reach the conclusion stated in the premise. That's what a premise is: a foundational assumption which guides all subsequent reasoning. It is not constraining in any way to assume that a thing might not be authoritative, in order to investigate whether or not it is authoritative -- it's the only honest way to investigate any question.
The speaker should be more than willing to assume that he might be wrong, and then undertake a fair investigation from there. If he's right and the bible is the ultimate authority on the Universe, then he can only demonstrate that by comparing it to extrabiblical reality. And again, if he's right, everything in the Universe should agree with the bible -- and even the nay-sayers ought to accept that as proof!
Why is he unwilling to strike the killing blow to his opponents' arguments, if he's certain that he's right?
​
In the following sections I'll show how this circular reasoning appears to lead the speaker back to his assumed conclusion.

The Speaker's Answer

Presented at 11:05: see very top for quote.
I'll address it claim by claim, as done by the speaker...

Claim 1: "... it's a reliable collection of historical documents ..."

At 15:08, the speaker cites the following as evidence in for this claim:

• The bible was written on 3 different continents
• In 3 different languages
• By over 40 authors from multiple walks of life: kings, generals, fishermen, tax collectors, doctors, historians
• In 66 volumes, covering hundreds of subjects
• Over more than 1500 years

So what? In all these ways it's similar to the Hindu scriptures, but does the speaker give any credence to those? Though he does mention other religious texts [3:57] and even presents them as alternatives to the bible, he doesn't discuss these so-called "strengths" of the Hindu scriptures (or any others) in his lecture: I think either he's unaware of them, or his premise -- that the christian bible is the highest authority -- has caused him to exclude Hindu and other scriptures from his investigation, because analyzing them the same way he analyzed the bible would cast doubt on his assumed conclusion. So, "why the bible?" when the Hindu scriptures and perhaps others are so similar in the ways the speaker cares about? Who knows? He didn't address it, though he should have.
But even if there were nothing remotely comparable to the bible in these ways -- why should it matter? Does the number of languages used to compose something somehow affect is authority? For that matter, does composing one work on the corner of 3 continents somehow make it more authoritative than another one composed on the edge of the Indian subcontinent, or in the middle of North America? And why should we care how many people wrote it, or their backgrounds, or how many separate books it's composed of, or how long it took to write?
I know what he's getting at: he's trying to say, "how could this many people, over such a long time, across such large swathes of multiple societies, all be wrong in the same way?" Well, that's a fallacy called 'argumentum ad populum', an argument from popularity. Just because a bunch of people believe something, that doesn't make it true, or even likely to be true. All the bible authors were Jews and early christians living in Eastern Mediterranean societies; they were well aware of earlier Jewish oral and written traditions, and likely tried to constrain their work to enhance rather than refute the existing traditions; and the works which weren't popular or didn't agree with existing traditions were not included as canon! The bible's internal consistency (such as it is) doesn't indicate that its contents are true -- it indicates that its authors prioritized internal consistency.
The speaker has made an argumentum ad populum, derived from evidence heavily affected by sample selection bias and observer bias. It's a terrible argument, built on terrible evidence. After a bit of thought, anybody who isn't operating under the speaker's circular premise should be able to see the problems with this argument.
​
At 17:40, the speaker seems to claim that the author of Luke was a historian, and that we should trust them at their word when they make claims, because as a historian they researched the claims before publishing them:

Luke was not an eyewitness -- he doesn't claim to be an eyewitness. He's a historian who claims to have traced the information from the eyewitnesses. ... The fact that this man was not an eyewitness, but collected information from individuals who were eyewitnesses [...], and has followed everything closely for some time past, and he wanted to write an orderly account. ... Luke's goal is history and chronology.

Well, Luke probably wasn't a historian in any modern sense of the word, so "history and chronology" in any modern sense probably weren't his real goal. Modern historical research didn't really happen in ancient times, so I'm reluctant to accept that when the author of Luke says he has "followed all things closely for some time past", he actually means he's found enough objective evidence to support the claims he's heard. It's not what he explicitly says, and that was not the common practice at the time, so I find it hard to believe that's what he meant.
Also, I don't think Luke 1:1-4 (cited by the speaker) implies that Luke tried at all to investigate the claims he received from others. Instead, this passage can easily mean that the author of Luke was told some stuff by people who claimed to be eyewitnesses, and he's just writing those things down because he believes them based on the story alone. It's not even clear that the author talked to the eyewitnesses -- he could have just talked to the "ministers" in verse 2, who told him they got it from eyewitnesses.
The Lucan author could be recounting pure hearsay, 100 retellings deep, as if it's fact -- or he could have gone to the ends of the Earth to verify what he heard. But he doesn't describe his sources or methods, so we don't know, and it's hazardous to guess... Yet the speaker hazards a guess, and tries to pass off that guess as truth. In this case, I think he's forcing his interpretation of the passage to match his assumed conclusion, and to do so he's made a lot of seemingly unwarranted assumptions.
​
Then at 27:47 the speaker says this:

"There have been more than 25,000 archaeological digs related directly to the subject matter of the bible. ... Not one of them has contradicted anything that we have in the bible, and the overwhelming majority of them have confirmed and affirmed the things that we find in the bible."

First off, I don't accept this claim at face value -- I'd like to see some citations, but the speaker doesn't give any. Also, biblical claims like the Genesis flood have been thoroughly debunked (though I think archaeology only played a small part). I bet a lot of archaeology has proved parts of the bible wrong, and Wiki seems to agree with me so I think I'm right to doubt the speaker's claim. But that's irrelevant to the point I'm going to make, so I'll move on...
I accept that some places and events in the bible are factual. That's no problem. These were people writing about their society and their time, so it would be ridiculous if nothing in the bible were factual. But the fact that it contains some facts does not imply that all its contents are facts.
"My name is Andrew Joslin. I live in the United States. I have black hair. I love cats."
Those 4 statements are internally consistent, and 3 of them are true -- so does that mean they all are? No. One of them is false.
In just the same manner, some things in the bible can be true, and verified by archaeology and science, while other things in the bible might be false. Just because we verified the Babylonian Captivity with reasonable certainty (Jer 52), that doesn't at all support the claim that a deity had anything to do with it (Jer 52:2-3).

Claim 2: "... written by eyewitnesses ..."

First off, from 19:31 - 20:50, the speaker very strongly implies that he thinks the traditional authors -- the apostles Matthew, Mark, Luke, John -- are the real authors of the 4 gospels. Over and over he says "Matthew is writing...", "his favorite words are...", "that's why we have his gospel written the way it's written", and other phrases which make it very unlikely that he is personifying the books, and far more likely that he is talking about the authors themselves and believes they are the same as the tradition says. But those authors are merely the church tradition, and this tradition is very much doubted by modern scholars.
Additionally, multiple times in the video [13:54, 40:30] he cites 2 Peter as if it's authoritative on what Peter experienced and thought. But modern scholars believe this book to be a forgery and not written by Peter, so I don't know why anybody would consider 2 Peter authoritative on what Peter experienced or thought. If 2 Peter is a forgery then the reference at 51:20 is also problematic, because I suspect that a person who forges a book by Peter may also be so bold as to claim that all scripture is divine in origin, as an attempt to give more credence to their own forgery.
All this makes me wonder how much the speaker actually knows about how the bible was written -- and if he does know what modern scholarship says about these things, I wonder whether he might just be throwing out the modern scholarly consensus in favor of his personal, pet beliefs (his premise that the bible is the ultimate authority). Neither is a good option, and either way you cut it this lowers my trust in the speaker.
​
Finally, at 21:20 the speaker claims that John was an eyewitness to... something. He cites John 1:1-3 to support this:

1 That which was from the beginning, which we have heard, which we have seen with our eyes, which we looked upon and have touched with our hands, concerning the word of life— 2 the life was made manifest, and we have seen it, and testify to it and proclaim to you the eternal life, which was with the Father and was made manifest to us— 3 that which we have seen and heard we proclaim also to you, so that you too may have fellowship with us; and indeed our fellowship is with the Father and with his Son Jesus Christ.

Okay, the author clearly says that he has both seen and heard certain, unnamed things, which have apparently convinced him of the truth of the message he is about to relay in the rest of his gospel.
I grant that the author is saying he "saw and heard" things -- but what? It seems like poetic language, and it doesn't make any distinction between the things the author has personally seen, and what he has heard second- or third- or nth-hand from others. True, the author may have personally experienced some stuff as an eyewitness, but it's unclear from these verses what that stuff was, and how much of the remainder of this gospel is hearsay versus eyewitness testimony. I'm not even sure that the author of John ever claims to have seen Jesus -- perhaps the rest of John proves me wrong, but from this passage it's entirely possible that the things the author experienced firsthand were more akin to what modern parishioners experience in church, than to personally witnessing the things Jesus said and did. People today say they are convinced by their own experiences without ever having seen Jesus in the flesh, so perhaps that's what the author of John is saying in this passage.
But even if the gospel of John were eyewitness testimony, that's still not great... Wiki says that "most scholars believe that John reached its final form around AD 90–110", so this would be eyewitness testimony that is, per most scholars, at least 57 years old at the time it was written down. We know for a fact that eyewitness testimony can be very unreliable. This study demonstrated the unreliability of eyewitness testimony for a somewhat mundane event. These are known cases where mistaken or perjured eyewitness testimony resulted in a wrongful conviction and death row sentence, and here's a study which indicates that high stress negatively impacts the quality of eyewitness testimony (specifically, it affects the eyewitness's ability to accurately recall the events).
If a crucifixion of a man named Jesus or Jeshua did indeed happen, then eyewitnesses to that event might have had some difficulty accurately retelling what they saw, even the first time they retold the story. This could be compounded with the eyewitnesses having heard rumors that he was a prophet, which might render their interpretation of what they saw vulnerable to suggestion. The long time period between the writing of this gospel and the events it describes is also problematic, because during that time it was passed on as an oral tradition, and continued retelling as a shared oral tradition can cause the recalled experiences to degrade in accuracy and become poisoned by later changes. That's how memory recall works: it's subject to errors and changes each time we do it. It happens to everybody, and to individuals as well as groups. It's not necessarily lying: errors can and do accumulate very quickly despite people's best intentions to be truthful.
So from the passages presented by the speaker, it's far from a certainty that the author of John was an eyewitness to the events described in the gospel of John. And even if he were, eyewitness testimony is extremely problematic, and frankly I'd consider it more likely that this eyewitness testimony has been corrupted by the factors described above, than the purported supernatural events in the story actually happened as described. Maybe there's more evidence to be found in John, but I find the speaker's use of this passage alone insufficient to support his argument: to call this evidence is wishful thinking or motivated interpretation at best.

Claim 3: "... during the lifetime of other witnesses ..."

At 23:22, in support of this claim the speaker says there's a huge problem "dating the problem late". I don't know what problem he's referring to, because he didn't explain it as far as I could tell. He then cites 1 Corinthians 15:1-8 as support for "... during the lifetime of other witnesses ..." -- however, in those verses Paul explicitly says that he's recounting a story he's been told. I've heard some speculation as to whether this may be some type of early christian creed, in which case it would have been meant as a statement of faith, rather than a discussion of facts in evidence (I find this plausible, but I can't back it up with evidence so I'm treating it as mere speculation).
But all speculation aside, in 1 Corinthians 15:1-7 Paul literally admits that he is not personally attesting to the veracity of what he's saying: he's repeating something he was told. Obviously he is personally attesting his own experience in verse 8, but all the rest is stuff that he was told and cannot attest to personally.
So Paul was told that "the 500" and a bunch of other people witnessed the resurrected Jesus, and that most of them are still alive. Therefore, when the speaker later [24:22] says this:

"If you do the math, there are at least 301 eyewitness to the resurrection who are alive when 1 Corinthians was written.

... I don't think the speaker has any justification to reach this conclusion. Even if Paul believed it was true, does that mean we should believe it? Again, Paul need not be lying here, nor do his sources need to be lying, in order for this passage to be a falsehood. Everybody in the chain from the eyewitness(es) to Paul could be doing their best to report the events accurately, and they could still have gotten it wrong.
Not knowing how long the chain from the eyewitness(es) to Paul actually was, again I'd say it's far less likely that the events described in the story are true, than that the message Paul delivers here was corrupted by false memories and erroneous retellings -- or even outright lies or exaggeration*** -- and therefore false. (***We don't know the pedigree of the story before it reached Paul, so we can't say that every middle-man retelling of it was honest. Even if you would die defending Paul's honesty, that still says nothing for all the people in the chain that passed this information to him.)
​
The speaker uses these verses again at 29:06, where he says this:

But what we find here in this text is, again, over 301 eyewitnesses to the resurrection who were still alive when 1 Corinthians was written. Why is this important? This is important because that means that the gospel message, that the message of the bible, is falsifiable. ... When you're testing the veracity of a claim, if somebody's making a claim and that claim can't be falsified, that means you can't test the claim. Not a very strong claim, if you can't test the claim -- that means I just gotta trust you, because there's nothing I can do to falsify your claim, I just gotta trust you. This claim is falsifiable. When Paul wrote it, it was a falsifiable claim, and yet it was never falsified. That's a piece of evidence that has to be weighed.

First off, even if the claim was falsifiable at the time it was made, it's not falsifiable now, and now is when we are being asked to believe the claim. People of Paul's time may have been able to interrogate these supposed eyewitnesses, but we can't -- and we can't even be sure they ever existed -- so their testimony can't falsify Paul's account for us. It's unfortunate that the evidence we need to falsify Paul's claims may be lost to time -- but that doesn't mean we should believe what he says, and as far as we can tell it actually renders his claims unfalsifiable to us. Per the speaker's own logic, this is a good reason to doubt what Paul says.
Second, as explained above, I don't accept that there were "over 301 eyewitnesses to the resurrection" still alive in time to read 1 Corinthians. Even if there were living eyewitnesses at that time, the following problems must be overcome before claiming this as evidence:

• Maybe 1 Corinthians wasn't published anywhere these eyewitnesses could have seen it, in time for them to falsify it. It's a letter to the church of Corinth (far from Judea, where we'd expect most eyewitnesses to remain), written in a language foreign to them (Greek), at a time when few people could read
• Maybe eyewitnesses saw it and didn't falsify it because it matched their (incorrect) understanding of what happened. It is possible for everybody to be wrong in roughly the same ways, that's how witness collusion and legends work
• Maybe eyewitnesses saw it and did falsify it -- but one of the following happened:
  • They chose to leave the area instead of risking voicing their objections to a popular belief
  • Their objections were overshadowed by the louder and more numerous voices which ended up informing the books of the bible
  • They voiced their objections verbally and never wrote them down
  • Their written objections were lost over the centuries (including the purposeful destruction of "heretical" texts by the church, rulers, and individuals)
  • We just haven't found the document yet

All of the above are perfectly reasonable explanations for why we don't have a specific, ancient document in our hands.
Also, for what it's worth, I'd like to mention that here the speaker is literally using absence of evidence as evidence of absence: this is an argument from silence, and it's fallacious here because it affirms the consequent by completely ignoring other very plausible explanations. Arguments from silence are perfectly fine when the absence of the thing necessarily implies the falsehood of the claim: for example, the claim "I have a green horn sticking out of my forehead" is falsified by the absence of a green horn sticking out of my forehead. Arguments from silence also be okay evidence (though not very conclusive) when there are good reasons to believe that if the claim were true we should likely have the evidence we lack. But here it is a no-no because what we know about the production, preservation, etc., of ancient documents gives us the most likely explanation for why we don't have the evidence.
So yeah, that's a horribly fallacious argument... And this one's obvious enough, and the speaker seems intelligent enough, that I'm going to just say it: of all the arguments the speaker makes, this is the one that most makes me suspect dishonesty. Maybe he's chosen to present this paper tiger in place of a good argument because he knows he has nothing better. It makes me suspect he's consciously chosen not to investigate his question, but instead seeks to prove his foregone conclusion by any means necessary.
Not that he's outright lying -- I think he really does believe his foregone conclusion. But I think he hasn't set out to honestly investigate it, and this awful argument is, in my opinion, a direct result of that flaw in his methodology.
​
At 30:44 the speaker states that the NT was written "very early", which I guess is supposed to support the "by eyewitnesses, in the lifetime of other eyewitnesses" prong of his answer. Yet he gives no evidence for this "very early" claim. I think these are the points where he tries to support the argument, but both seem to be non sequiturs (fallacies):

• At 31:30 the speaker argues against a straw man of the popular "telephone game" argument
  • It's a straw man because the telephone game argument is a description of how both transcription and translation errors accumulate in hand-copied texts over time -- however, the speaker presents it as if everybody who ever translated the bible had the same source material to translate or transcribe from. That's simply not true. It's been proven that differences exist in the earliest known copies of every book of the bible, and these differences grew over time. Medieval scribes didn't have the originals to copy or translate from: they were working from copies of copies of copies, etc. Indeed, Bart Ehrman says that the earliest scribes tended to make more errors than the later ones.
  • It's a non sequitur, because it was brought up in the context of trying to prove that the NT was authored "very early", and it actually has nothing to do with that, so it's probably a relevance fallacy of some type. The "telephone game" argument explains how copies of copies become less and less true to the originals. It does not comment on the date of the originals, yet that's what the speaker is trying to prove here.
• At 34:54 the speaker claims that we have over 6000 manuscripts or fragments of the NT, which is more than we have for other ancient texts of similar age
  • This is a non sequitur for a number of reasons, at least one of them a relevance fallacy. First, the books cited by the speaker are generally quite a bit older than the books of the NT -- by many hundreds of years, in some cases. Second, the number of fragments has nothing to do with when the books were written, which is the point the speaker is trying to prove.

I feel that these two arguments actually distract the audience rather than supporting the speaker's claim. I don't know whether this was his intent, or a mistake, or I'm just being dumb -- mainly because I have no idea how he thinks these points support his claim. At the very least they distracted me, and after re-watching them multiple times I still couldn't make any better sense of these arguments than as non sequiturs based on straw men.
If you think he's supported his "very early" NT authorship claim at all with these points, then please let me know how.
​
But regardless of my poor understanding of this section of the video, or the speaker's lack of evidence, or whatever happened here, I don't think it even matters. Even if the NT books were written "very early", it would not mean that the lack of contemporaneous objections to the NT's claims constitutes evidence in favor of the NT's claims. Again, arguments from silence are not appropriate here, and I really do suspect that the speaker is being intellectually dishonest here, as discussed toward the beginning of this section.

Claim 4: "They report supernatural events that took place ..."

At 40:30 the speaker cites 2 Peter in support of this claim. Aside from the problems I already mentioned with 2 Peter, and how (in my opinion) the speaker's usage of that book diminishes his credibility --
Why would it matter that the authors claim that supernatural events happened? Should we just... believe them? It's one thing to say "I saw X". It's another entirely to say "I saw X, and I know that Y caused it". The first is a statement of one's own experience, whereas the second is an experience plus an inference. Why should we believe that these peoples' inferences about the supernatural are reliable, and that the reported events (assuming they actually occurred) were actually supernatural?
Note that my objection isn't based on demeaning ancient peoples. I don't think this problem really gets any easier with more knowledge. Inferences about the supernatural should always be treated as speculation, until and unless we find some way to objectively investigate the supernatural. We don't have a way to do that now, so we should not believe the claims (yet).
More support for this claim is given at 41:33, but it suffers from the same problem.
The speaker should be treating these claims as what they are -- claims, which need to be substantiated before anybody should believe them. He's not doing that. I don't know if he just doesn't suspect that they could be wrong, or if he's turning a blind eye to a problem he's aware of. Either way, it's just very unsatisfying, and consciously or not I wonder whether his circular premise "there is no higher authority than the bible" has crept into this part of his analysis, too.

Claim 5: "... in fulfillment of specific prophesies ..."

The speaker supports this argument with Isaiah 53 at 43:02, and with Psalm 22 at 45:44.
I read Isaiah 52:13 - 53:12, and to me it's not that impressive. It's not a specific prophesy, because it doesn't tell when the thing will happens, and many people (and even whole nations) of that area and timeframe probably fit that description. Jesus is just the guy that got super popular (though he was not the only one).
​
I agree that Psalm 22 seems to describe somebody being crucified. Or it could be another method of torture that I don't know of, but let's just assume it's crucifixion for the sake of argument. However, it shares the same problems as Isaiah 53: it doesn't give any specifics, so it could be talking about literally anybody from that time and place who was crucified. Jesus quoting the first line while on the cross could easily have been a detail made up by the gospel authors (or the people who participated in the oral tradition), as a way to heighten the image of Jesus as the messiah. They wanted to tell a compelling story, and that would be a great way to make it more compelling to a Jewish audience.
Anyway, the speaker says that at the time of writing Psalm 22, crucifixion had not yet been invented -- but he didn't cite any sources so I don't know if he's right or wrong. I looked it up quickly, and Wiki says "The psalms making up the first two-thirds of the psalter are predominantly pre-exilic and the last third predominantly post-exilic", I think referring to the Babylonian Exile from 586-539 BCE. Since I can't read Wiki's reference I don't know if Psalm 22 is in that pre-exile group, but I'd guess so, and that's the most generous assumption I can make so let's work with that. That gives us an early 6th Century BCE date as the latest possible date for Psalm 22 being written down...
... And here's a reference saying the Persians were crucifying people "systematically" in the 6th Century BCE, and that they probably got the idea from the Assyrians and Babylonians, so those countries may have been doing it earlier than that. So contrary to the speaker's bald assertion, there's some plausible overlap (as far as I can tell) between when Psalm 22 was first written down, and when crucifixions were performed in the region. Yes, I'm working off of the manuscript date rather than the actual date it was composed, but I think that's fine: Psalm 22 began as an oral tradition, and perhaps the crucifixion details were added into it before it was written down, once people became aware of the practice. I think that's far more likely than Psalm 22 being a prophesy, and since we can't reconstruct the original oral tradition we'll just have to wonder.
​
Also, prophesy in general has a few big problems:

1. People who know of the prophesy can work to fulfill it
2. People retelling a story can alter the details of the story to make it seem like the prophesy was fulfilled
3. It's sometimes not clear whether something is a prophesy at all, or what is being prophesied

Both "fulfilled prophesies" cited by the speaker suffer from all these problems.
The authors of the New Testament obviously knew the OT books well, and were motivated to make Jesus seem like the Hebrew messiah -- that's why they wrote the gospels in the first place. That would give them a strong incentive to either make up parts of the gospel stories wholesale to better match the prophesies, or to selectively interpret the things they heard or experienced in a way that makes the events fit the prophesy better.
And even if there wasn't much embellishment, couldn't it be that Jesus and the apostles actively worked to fulfill as much of those "prophesies" as possible? A great quote from Matt Dillahunty: "If I go to a restaurant and order a steak medium rare, and the server gives me exactly that, is he fulfilling prophesy?" In my opinion, nope, he's merely following instructions, just like Jesus and the apostles may have merely been following a script. I understand that some people might still call this "fulfilling prophesy", but given the other 2 problems I think this idea of "fulfilled prophesies" is still on super thin ice.
Finally, Isaiah 53 is often interpreted by Jews as a prophesy for the nation of Israel, not the messiah. And I think they believe Psalm 22 is just a poem or song, not a prophesy. You can claim they're prophesies, but it's not clear that they were intended to be, or what exactly they predict, so when they're "fulfilled" (especially as questionably as in this case) I'm not sure how much that really means.
​
This isn't a great case for the "... in fulfillment of specific prophesies ..." claim. It looks like wishful thinking to me, again perhaps motivated by the speaker's premise that the bible is the ultimate authority. Or maybe I'm wrong and somebody here can do a better job supporting this position than the speaker did.

Claim 6: "... and claim that their writings are divine rather than human in origin."

At 51:20, the speaker cites 2 Peter 1 to support the claim that the bible authors claimed their writings are divine in origin. I've already noted my objections to using 2 Peter (a likely forgery) as evidence for anything that Peter the apostle experienced or thought --
But just as with claims for supernatural events, even if 2 Peter is not a forgery, why would it matter that the authors claim the bible is divine in origin? As discussed above I think it's very unlikely that Psalm 22 or Isaiah 52/53 are fulfilled prophesies, so now where are we?
We're left without any supporting evidence for the claim. They said it, so should we just believe it? As with claim 4, this is just very unsatisfying, and I wonder whether the speaker's circular premise had something to do with it.

Final Bones to Pick

I wish I could address his points at 52:12 and 53:15, even though they're not directly related to the rest of the talk -- but I'm out of space.
The first is an appeal to consequences built on an equivocation fallacy, and in the second he describes the questions one must ask in any historical investigation -- questions which he addressed poorly or not at all in this video.
These two attempts to twist logic into a shape that supports his point -- well, they disgust me.

Weekly Anti-Character Discussion: Miguel Caballero Rojo

Sections

• Resources: Players, Guides, Matches
• Strengths and Weaknesses
• List of CH Launchers
• Miguel's Punch Parry
• String Variations
• Favorite Moves and Punishing (Neutral)
• Favorite Moves and Punishing (SAV)
• Throw Situations
• Wake Up
• Matchups
• List of Confirmed Followups
• Round-Up

Resources: Players, Guides, Matches

Names to Know

• Sephiblack - Youtube Channel - Twitch Channel

Sephiblack is well known for his Miguel gameplay. He's a very strong player, willing to take some interesting risks to push forwards and establish the close-range respect Miguel thrives off of. He's been playing him for a while and hasn't given up on him yet, and he knows all the little minutia such as guaranteed damage, frame traps, situations, etc. His YT has many matches against known names in the scene, tips on improving your game (though not specifically Miguel) and self-analysis.

• Glaciating - Twitch Channel

Glaciating has a bit of a spotty record, he doesn't like travelling but his presence has been made known in online tournaments. He has been representing Miguel for a long time! A well rounded player with a good intuition.

• Hobbes Obodo - Youtube Channel - Twitch Channel

A very dedicated Miguel main that has put on an enormous amount of long-form content discussing the character's weaknesses and strengths. Don't let the format of this "anti-character" discussion post fool you - if you go to his channel, there won't be a single thing you don't know about this character and you will be able to counter him effectively.
Other Resources

• Applay's Tekken Library - Basic moves, combos, punishes for everyone
  
• Applay's Basic Punishment Guide - 15 moves to look out for against online players
  
• Applay's "Five Moves you shouldn't let MIGUEL get away with" - Self explanatory
  
• Kingjae, Teach Me: Miguel ft. DVK (AFR) - A long and meaty video explaining how to play Miguel
  
• Kingjae, Teach Me: Miguel Top 6 Tips and Secret Tricks ft. Sephiblack - A long video w/ Sephi about Miguel
  
• A guide by a user on the Yoshi Discord that shows jab/flash interruption for all character strings
  
• Miguel Sabaki Parry Quicknotes by Hobbes Obodo - A short but detailed guide on how Miguel can use SAV b+2 when minus to get a launch.
  
• Miguel Command/Move List, Season 4 by Jaber Al Marri - A useful video simply because it includes the updated version of his moveset.
  
• Miguel Framedata, Season 4 by RBNorway - For any specific question I may not have answered or frames I may not have mentioned. If you have the BKNMokujin Discord bot, you can mention the inputs to also get a gfycat video of the move.
  

Matches/Sets

• Glaciating vs Shadow20z, Anakin Invitational Grand Finals - Though this ends poorly for Shadow, these two players have history and he knows by now how to control Miguel's approach, jab his offense back to neutral, and time his low blocks and parries against a very frightening set of lows. ~12 minutes
  
• Glaciating vs Akash, The Danger Room - A FT10 exhibition match that goes 9-10, Akash's Lee is on point but so is Glaciating's Miguel. A very long set but one worth watching to see how Akash deals with a character able to dominate close range and retreat easily outwards. There are also some strange moments that demonstrate some of Miguel's fringe strengths like side-step tracking. ~57 minutes
  
• Sephiblack vs SuperAkouma, Fighting Games Challenge 2019 - A famous set for Miguel players and another one where he wins. That isn't to say that SuperAkouma does not have good ducks against Miguel's strings and SAV string mixups. 13:05, in exchange for a weaker power struggle you get a much quicker set.
  
• Sephiblack vs Glaciating, S4 Mirror - A true treat for anyone looking to learn or fight Miguel. Two of the most prominent players mirror matching each other on the character with two different playstyles (extreme aggression vs extreme defense), and despite the connection being 3 bars, there's no shortage of notes to take. 35:55, with some helpful commentary on Glaciating's plays from Sephi.
  

Strengths, Weaknesses, Playstyle

Strengths

• Good punishment - Miguel's punishers often leave him with good frame advantage, a chance to enter SAV, or decent damage
  
• Meaty Frames - Miguel is able to put himself at a frame advantage on hit and on block fairly frequently.
  
• Damage and Combos - Many of his launch combos are fairly easy and are on the damaging end, while having excellent wall carry options, wall enders, and floor breaks.
  
• Mini Combos - A long list of confirmed mini-combos that make every hit worth double the damage.
  
• Counterhit Launchers - Miguel has a VERY long list of CH launchers (b1, SAV33, b22, b3, SAV11, SAV121, SAVb14, etc etc....) that flow into his kit well, allowing him to persistently threaten the opponent.
  
• Okizeme - It's hard to wake up against Miguel without taking damage, thanks to a Steel Pedal, a hatchet that hits grounded and tracks to his weak side, and a few other moves.
  
• Mixup Intensive - At a close range Miguel is extremely overwhelming thanks to a large collection of fast CH launchers, frame advantage, and the ability to transition into an extremely lethal stance (SAV or Savage)
  
• Safe/Deceptive on Block - Many of Miguel's moves are at first unintuitive to punish, and many players will miss the chance to punish some of his -10, -14, and even -17 moves without labbing.
  
• Difficult to Sidestep - A lot of his core moves are either homing or track to his sidestep weakside, making it require precise inputs to sidestep a Miguel that knows what he's doing.
  
• Long Legs and Forward Movement - While his arms are short, Miguel has some of the longest legs in the game and is able to use this to his advantage in pokes from outside his comfortable range. Many of his punch based moves give him forward momentum that assist him in getting inside the enemy's bubbles.
  
• Decent Throws - Miguel's 2+4, side throws, and his standing command grab all put him in good positions on wakeup.
  

Weaknesses

• Mediocre Defense - If his opponent is an aggressive character as well, Miguel needs to fight tooth and nail to stay on top. While he has three viable panic moves, the lack of variety, evasion, and safety from using them puts him in an easy to bully situation.
  
• Poor range - Although he has some good pokes with good range, he still suffers from issues using certain moves like 2,1 as they have no arm range or forwards momentum. Spacing Miguel with your character's generic df4 can compromise his gameplan.
  
• Sluggish Moves - Some of his better moves can be somewhat slow to come out, like b+3, or f+4, when trying to use them for their intended purpose.
  
• Risky - When you get past the deception some of his moves offer, mostly from matchup knowledge, Miguel suddenly becomes an extremely risky character. (db3,)4 is -18 on block, (SAV 1,2)1 is -17, b+4 is -14, etc. Despite these moves being weird or hard to punish from a glance, they're actually very bad for him to throw out randomly.
  
• No Throw Game - Miguel only has the generic 1 or 2 break throws and a single 1+2 break throw. While he does have Ultimate Tackle, it's not easy to hit and only comes from FC.
  

Playstyle
Miguel has three big things important to his gameplan:

1. Get IN
2. Bully them with mixups
3. Bait them into counterhits

While he has some okay whiff punishment, Miguel shines when he is relentless on the opponent and forcing them to guess between ducking or standing, extension or not, delay or instant. He excels at range 0, but struggles with zoning and can spend a long time looking for openings from his pokes or through whiffs to put the opponent on the ground and begin torturing them. Being hard to sidestep and having a high damage wall combo, he likes putting the opponent's back to one.

List of Counter-Hit Launchers

Q: Why have this section?
A: Miguel has a prolific list of various different CH launchers. Many players do not know the full extent of his moves that can CH launch, so I think it would be appropriate to list them all here for safety's sake.
Click the move name to see a short clip showing it and basic information. Tell me if the links are not working.
Neutral

Move	Properties	Suggestion
b+1	11f, High, -9 on B, +2 on H	This is a very tricky move and one of Miguel's signature panic moves. Although it only hits High, it hits 11f in, making it possible for him to snipe you out of a mixup or a string if you choose to delay. The range is minimal, the recovery is extremely long on whiff, and it's linear. The best option is to duck or sidestep when you think it's coming.
Magic 4	12f, High, -9 on B, +5 on H	A CH launch magic 4, the range has been nerfed in the past, but it remains something Miguel can use at a slightly longer range than b+1 to go for a combo starter. Duck this like you would b+1, or you'll get taken to wall. Common to see at round start.
(b+2),2	16f Mid,-7 on B,+3 force crouch on H	The first hit is a high, but it is Miguel's fastest neutral homing. If you block or get hit by the first hit, it's best to respect it and not interrupt. It's safe but minus, where the alternative is walking into a mid-CH launcher with high damage potential. You should be able to duck and launch.
(df4,1),1	14f, Mid, -10 on B, +7 on H	This move comes from a fairly scary string of Miguel's. If the second hit connects, he's either +6 or -5, meaning he can enter SAV and torture you or enter SAV and punch parry you. The extremely large window to input the final elbow means that he can also bait out counterhits. Because it's only -10 for the whole string, duck the second hit for a WS launch.
(1,2), 1+2	10f, Mid, +4 on B, guaranteed stomp or steel pedal on H	Because Miguel's jab string can end in a punishing high that grants him a chunky followup or + frames, and the 1+2 ending though slow is a + mid, many players are scared to interrupt these jab strings. Ducking and jabbing is the basic counter but can be low-parried on a read, the absolute safest method is to duck and then sidestep out of the way. Difficult, but likely the best option.
(1+2), 1+2	19f, Mid, -14 on B, airborne on H	Although this is a slow move, it has a chunky hit and a huge delay window. The -6 without SAV transition makes it safe to block, and -14 makes it profitable to punish.
(f+3),4	20f, Mid, -15 on B, flip on hit	This string is not extremely good, but the long range and even longer delay window give Miguel players an opportunity to trick the opponent into rushing in. The ease of punishing this string is often underestimated, but not everyone can launch it. Figure out what works for your character based on range and don't let this string abuse you. Natural hit.
(3,)4	13f, Mid, -12 on B, knockdown on hit	The first hit is a fast high, but if you're in close range, be careful. Miguel puts himself at -7 which means no continuation will fork over his turn, but the followup can and will launch overzealous players for a decent combo. Ducking the first hit or punishing the full thing are your options here - be warned that this is a natural hit if the 3 connects and a block punish move.
d+3+4	21f, Mid, -15 on B, flip on H	Miguel's very own steel pedal. Can be hard without wall for some characters to launch punish it. Beware this move on wakeup, as you'll either be on the floor again or counterhit. This move is linear to sidestep but can catch you while rolling.
b+3	30f, Mid, +7 on B, +7 force crouch on H	Because this move gives massive advantage, forces crouch on hit, has a SAV transition, is a CH launcher, and crushes lows, it's a nasty tool to deal with despite the slow speed. A side walk or step to either direction will beat it, but SSR can be a little trickier. Try to backdash or step this move as you do not want to block or be hit by it.
(f+4),2	17f, Mid, -12 on B, knockdown on H, Homing	f+4 is one of Miguel's most important pokes thanks to being long range, homing, and a mid. If you get hit by the first hit the second is guaranteed, while he can also enter SAV at +7. If the f+4 CHs, nothing special happens. Like many of his moves, let Miguel do his thing and don't press buttons if you want a punish or your turn back.
(df1,1),2	13f, Mid, -12 on B, +2 on H	Miguel's df1 series is very daunting to those who aren't familiar with him. With df1 and df1,1 both having SAV entrances and df1,1,3 being a delayable low, all of the variables of this string can confuse players greatly. The best option when this string comes out is to duck under (df1,)1 or wait it out and choose between the low (KND on CH) or the elbow (CH launch) to block. Jabbing the string is possible, but can lead to the punch parry.
b,df4	27f, Low, -15 on B, +8 on H	A weird input, slow low (though it is homing.) This move does not launch naturally. Though it does provide a SAV transition and is long range, it's way too telegraphed and punishable and slow. The best thing this move is for is okizeme, or the pure element of surprise as so few people use it. If you have a 15f hopkick, then your block and counter are the same... All the same, it packs a punch on hit and on counter-hit.

SAV Stance

Move	Properties	Suggestion
(SAV 1),1	12f, High, -9 on B, KND on H	This move is fast, but more importantly it has a diverse set of followups. SAV1,4 is a fast-mid wallbounce, SAV 1,2,1 is a highly delayable string that can end in a launch, while SAV 1,1 is a high-high CH launcher. Because SAV 1 is 0 on block and has two powerful mid followups, dealing with this move can be somewhat difficult at first. If you feel confident, you can duck, while if you think that Miguel is only doing SAV 1 repeatedly to scare you, it can be jabbed. On hit, SAV 1 confirms 1, 2, or 4 followups but not SAV 1,2,1.
(SAV 1,)2, 1	12f, High, -17 on B, Launch on H	Coming from a string with high delay capabilities, this move can be scary to press buttons against. If the second hit is a counterhit, the final hit is guaranteed. Though it has big pushback, it's quite easy to launch this move and shut down players expecting you not to know that it can be launched without wall. SAV 1,2 is -10 if they don't complete the string, so be sure to punish that as well.
SAV 4	15f, High, 0 on B, KND on H, Homing	This move is a fast and mean homing kick, on normal hit it gives SAV df2, while on counter hit it screws. It's fast, but 0 on block, so the best option is to duck this or jab it on block.
(SAV 3),3	15f, High, -9 on B, +3 on H	The first hit of this string is a mid and a set up into Miguel's punch parry. The time between hits can be long, but the threat of a CH high and the ability to go back into SAV for a mid after the first knee makes it somewhat paralyzing. On a read you can duck and launch between the delay, but Miguel is -9 after blocking the high kick so it may be worth it to wait to be safe. Without delay you cannot recover to duck after blocking the first hit.
(SAV b+1), 4	14f, High, -10 on B, +8 on H	SAV b+1 is a 14f mid homing move, that sets up into Miguel's punch parry. It is an extremely dangerous and key move, making the followups safe to initiate. The knee will launch on CH, and give advantage on hit, while the SAV b+1,2 string gives some extra damage. It's -10, so it can be hard to get rewarded for blocking this string, but it's well worth it over what can happen if you press.

Miguel's Punch Parry

SAV b+2, known in the move list as "Tornillo", is a 26f, Mid, -9 on block, +4 on hit punch. However, it has a long window to parry high or mid punches that guarantees a launch. Experienced players will naturally try to jab Miguel's strings, since many of them have long followups or long delay windows, which is where the punch parry comes in. Knowing when this can happen is very important as it can save your life.
Miguel Sabaki Parry Quicknotes - Hobbes Obodo
Active reversal window: i3-i10, or 7 frames
By utilizing frame knowledge we can see how to use this move when minus on block. Essentially, any move up to -7 can be used to set up a parry of a 10f jab, while at -8 you can parry 11f moves (WS punches for instance.)
Common Punch Parry Setup Moves

• Neutral 2,1~f (-4 on block)
  
• Neutral df1~f (-2 on block)
  
• Neutral df1,1~f (-3 on block)
  
• WS+1~f (-3 on block)
  
• ub+1~f (-5 on block)
  
• df4,1~f (-5 on block)
  
• d+4,1+2~f (-8 on block, catches WS+1)
  
• SAV df1~f (-2 on block)
  
• SAV 3~f (-5 on block)
  
• SAV b+1~f (-7 on block)
  
• SAV b+3~f (-7 on block)
  
• SAV 1~f (0 on block)
  

Characters with magic 4s or FC downjabs can counter this move, however they risk eating a followup in many cases like SAV b+1,4 that could be just as deadly thanks to the CH launch property. Be careful and take note as to whether or not the Miguel has used a setup into a parry before or is repeatedly doing setup moves without following up (to see if you jab.)

String Variations

A very pressing issue with Miguel's movelist are the dozens of different ways he can end a string. Entering SAV, or having two different options (usually one as a counterhit launcher) can put a lot of pressure on the opponent to come up with something and get out, but making their guesses very high stakes.
Strings with Multiple Endings

• 1,2,4 or 1,2,1+2

Ducking then sidestepping beats both endings and low parries. Dangerous as they are +3 and +4 (force crouch) on block. WS launching is hard as SAV link shortens recovery.

• df1~f or df1,1~f or df1,1,3 or df1,1,2

Jabbing is the safest for the first two hits (beware the parry), and the low can be parried or hopkicked and the mid can be punished well.

• df2,1 or df2,2 or df2,d2

First is launch punishable, second is -6 and slow, third crushes lows and is only -3 leaving him at position to sidestep. The latter two have long delay windows and slow startups on the second swing that can be jabbed sometimes.

• df4,1~f or df4,1,1

Ducking the second hit is the key to making this string fall apart. If you block it, you can be in trouble thanks to the long delay and punch parry possibility. The final hit is -10.

• db3~f or db3,4

The first hit as a SAV link is weighty at +4 on hit and only -12. The second hit can be done on block and be a devastating, sneaky and chunky round ender. The second hit is launch punishable.

• ub1~f or ub1,4

A set up in to a punch parry or a very plus on hit low, both hits are slow and telegraphed.

• fF2,1 or fF2,2

A safe approach that pushes the opponent toward wall, the fF2,1 variant can be ducked but the fF2,2 is Mid-Mid and -13. I believe this can be fuzzy guarded.

• SAV 1~f or SAV 1,4 or SAV 1,1 or SAV 1,2~f or SAV 1,2,1

This extremely tricky series boils down to two rules: One, never duck as all four endings are -9 or punishable. Two, SAV 1~f is not as powerful as it seems, SAV 1 is the fastest move SAV has at 12 frames, making SAV 1~f risky. If the Miguel is spamming SAV 1~fSAV 1 then you should be able to jab or downjab him. Beware punch parry.

• SAV 3~f or SAV 3,3

It's best to let this one play out. If you block the first hit and the string isn't delayed you can't do anything, if it's delayed you may eat a CH launch, or a punch parry. The parry and the second hit are -9 which leaves you with your turn back.

• SAV d+4~f or SAV d+4,3

The second hit is guaranteed on the first. It's a very fast low but it's likely you'll counter this move while looking for Hatchet. Natural combo.

• SAV b+1~f or SAV b+1,4 or SAV b+1,2

While the mid 4 is very sudden, and scary, it's punishable at -10. The low 2 is much slower and if there's a slight delay you can low parry/hopkick without truly having to react. Beware the SAV b+1~f as this can be a punch parry setup or a setup into the b+1,4 CH launch. A bit of a catch-22 as respecting the SAV b+1 too much will lead to other setups like Hatchet.

Favorite Moves (Neutral)

Applay Basic Punishment Guide - 15 Common moves to see online and how to deal with them
Five Moves you shouldn't let MIGUEL get away with by Applay

f+4,2 | f+4~f

This was one of Miguel's favorite neutral moves since before Season 4, and now it's even better than it used to be with its new SAV transition. f+4 offers a very long range mid homing poke, giving Miguel a tool to defend with when the opponent is at range and trying to get in. It can also offer him a chance to get his own offense started at closer ranges thanks to being +8 on hit and linking to SAV. On hit, the 2 followup is guaranteed and will knock the opponent down. If the opponent presses buttons between each move then they will get launched. Being safe on block ties together this formidable poke.
This move is slow, it's easy to sidestep and still have time to block afterward. On block it is -8, so he cannot punch parry you either. The f+4,2 full string lands at -12.

df4,1,1 | df4,1~f

Coming off of a fast mid knee, this move propels Miguel very far forward on every hit. The delay window between the second hit and the third is very long, giving Miguel an easy fast-mid-CH launch tool. At -5 on the second elbow, he can easily transition to SAV to punch parry you if you think he's going to delay the last elbow. This tricky string eats players alive when they haven't studied the move well.
The first and third hits are mid, but the second hit is a high. There are no other extensions and there is no real delay window between the first and second hit, meaning you can safely duck in preparation for the second hit and get a while-standing launch off. If you block the entire thing, you get a -10 punish.

df3,2

A mid-mid string with decent range on both hits and a little bit of frame advantage to top it off. Commonly used as nothing more than a poke string, careful that you aren't counter-hit as you will give Miguel more frame advantage than he would have on a normal hit.
-6 or so on block with no SAV extension, it's not too threatening.

2,1 | 2,1~f

At Range 0 this is a very powerful move coming out at 11f. Though they are both High you cannot duck the second after blocking the first. On block it will put him at -3, allowing him to sidestep or transition to SAV, while it also functions as an 11f punisher that will put him at a staggering +7 which gives him free reign to enter SAV or do a different move from neutral.
The best solution to this move is to consider whatever counter action you would like to take, and delay it by just a moment. If Miguel side steps you can catch him, and a fast 4 will catch his punch parry. Be careful as he can use the threat of the punch parry to enter SAV safely from being minus, since you might choose to not jab interrupt.

uf+1 | uf+1~f

A dangerous oki tool thanks to being a mid with a low reach and crushing lows. +4 on block with transition to SAV, along with an untechable knockdown, this move is extremely dangerous to go against and will be one of the tools in a more seasoned Miguel's arsenal. There is no good way to deal with this move other than sidestepping as it is extremely linear even to his strong side - the problem then becomes the fact that the closer you are when you sidestep, the farther Miguel sails past you, and the harder he is to punish.

fF2,1 | fF2,2

A favorite move for approach among mid-level Miguel players. fF2,1 is mid-high, but is safe on block and pushes his opponent far backwards giving him the ability to control the space. fF2,2 is mid-mid, but unsafe for him on block at -13. This move is used a lot in combos as the 2 extension gives a high wallsplat and the 1 extension breaks floors. Where people commonly mess up with this move can be boiled down to a few things: trying to hit between swings (don't), underestimating the range on the first hit (DON'T), and letting him get away with a jab punish or nothing on -13 (DON'T). This move can be fuzzy-guarded and easily shut down. If you're near the wall it's linear to sidestep the first hit. Miguel should not be given this free entrance into your space no matter what.
Has a soft feint between swings that can be launched.

db3 | db3~f | db3,4

An insidious kick to the ankles, this leaves Miguel +4 with a chance to enter SAV and only -12 (thanks S4!) on block. The extension is fatally punishable (-19~18), but it is incredibly sneaky thanks to deceptive range and the ability to be used even when db3 is blocked. It is a round stealer and an excellent tool for Miguel to bully players with when they are panicking and making bad decisions. It is -9 on hit, but it does its job effectively most of the time.

b+4 - Panic Move!

Although this move is -14, making it severely punishable on block, it's also an 18f armored mid kick with very long range. Many Miguels will rely on trading with this move as it does a chunk of damage, pushes the enemy very far, and will also bounce them off of the wall. It's an incredibly loaded move that makes for a compelling panic choice, but it's rather predictable and very punishable. Don't let the short blockstun fool you, it gives a lot of damage.

b+1 | b+1~f - Panic Move!

One of his most famous moves. An 11f, high, counter-hit launcher. This move is a fairly predictable, but it is safe (-9) on block. The whiff recovery is EXTREMELY long, even with the link to SAV, and it's somewhat linear. An easy way to avoid the grief that comes with this move altogether is choosing to not finish whatever pressure you had planned and waiting to see if the Miguel is going to interrupt you. Failure to do this can shut down some characters like Hwoarang fairly quickly as the Miguel only needs a split second to send you to the ground.

d+3

Although it's not very glamorous, this is a long range poke that is somewhere in the low 20s for speed.

WS 1 | WS 1~f

At -5 on block, this sets up for his sinister punch parry game. Registering at a massive +8 on hit, but critically lacking range.

WS 4

Similarly unpunishable, this WS4 gives a good chunk of damage while also having a very long range. It's common to expect it coming at ranges where the Miguel is not confident that he can force a block on the WS+1.

Favorite Moves and Punishing (SAV)

SAV db3 | SAV db3~f "Hatchet"

One of the most important and recognizable moves in Miguel's entire moveset, not just Savage alone. Dealing a chunk of damage, tracking to his weakside very well, moving far forwards, hitting grounded, giving beefy frame advantage, and going back into SAV for more mixups make this move a seriously terrifying low to deal with. SAV is full of scary moves, but this takes the cake. Being able to force an opponent to deal with a mid or a low that will eat their shins alive puts them in an uncomfortable spot and is the key to Miguel's Range 0 supremacy. A low parry isn't too satisfying either, considering the damage that's at stake (Miguel can often throw a SAV df2 to get himself a launch between uses of hatchet).
TIPS: This is -13 on block, making it a launch for some. Many Miguel players will open with this move upon transitioning to SAV, and are prone to doing at least two hatchets before alternating to a mid. Many weaker players will not properly mix-up their SAV game when trying to get started.

SAV b+1 | SAV b+1~f | SAV b+1,2 | SAV b+1,4

Thanks to a buff that made SAV b+1 homing, and (SAV b+1),4 a CH launch, it is now one of Miguel's favorite pressuring tools and ways to force respect at a close range. SAV b+1 is -7 on block, making it ideal for the punch parry game, a 14f homing mid which makes it impossible to get away from, and it has a mid/low mixup that can end in a counter-hit launch. As terrifying as this move is, SAV b+1 itself has no real power. The extensions or transition back into SAV are where all of the real power comes from - it's better to defend and let a player do SAV b+1 into itself infinitely rather than try to interrupt it. A hopkick or low parry will beat the 2, while the 4 is -10 and the punch parry is -9. If the player goes into another move, you can go forwards from there.

SAV df2

This move does more than just launch. While it is not considered crouching, it has an insanely low profile, making it able to duck jabs on startup to guarantee a painful launch. It tracks to Miguel's weakside, can track rolls, and flips over grounded opponents. Despite its appearance of having a large amount of push-back, it's -17, and quite punishable. This will be commonly thrown out after Miguel has established frame dominance, typically with his SAV db3, in order to break your blocking defense.

SAV 2

A fast, -9 mid punch. The low profile allows Miguel to go under highs, while tracking to his weakside, wallsplatting for a combo (or a mini-combo in certain situations), it breaks floors, it does good damage, it's guaranteed in a few scenarios, it has decent range, it hits wall slumps, and has an untechable knockdown. This move is an absolute monster, and due to its speed (16f), he can throw it fairly often after a transition or within its maximum range to check the opponent and get inside quickly. The move is extremely non-linear despite its appearance, but being -9 he will give up his turn. Be on the look out, specifically from moves like 1,2,4~f.

SAV 4

A 15f high homing kick that's 0 on block, gives a guaranteed SAV df2 on hit, and screws on counter-hit. If you block this, Miguel cannot transition back to SAV. Jabbing after blocking it will at worst trade with his jab, while ducking it has obvious benefits. Overall the move is not hard to disarm, but typically comes from setups that encourage sidestepping or might push the enemy to press a button in order to escape pressure.

SAV 1 SERIES

SAV 1 series is complicated to deal with. While SAV 1 itself is a high, it's 0 on block, and it has many extensions. SAV 1,1 is high-high, but it gives guaranteed damage and okizeme to Miguel. SAV 1,2 and SAV 1,4 are both mids - the first leaves him -10 on block but advantaged on hit to continue into a mid launcher or back into SAV, the second is an imperceptibly fast mid WALLBOUNCE that is -10 but with enough pushback to completely confuse the opponent as to whether it's punishable at all.

SAV b+2

(See above section "Miguel's Punch Parry")

SAV d+4,3

A 15f low with minor range, the primary strength of this is the chunk it takes out of the opponent (the 3 is guaranteed to my knowledge) while having almost zero animation whatsoever. The animation consists of Miguel moving his back foot forwards and hitting you in the shin with the side of his boot, but his front leg does not move and his upper body stays stiff in the SAV posture. Although it isn't a big move to throw by itself, it's often used to mess with people's heads when they are defending against a mid or expecting hatchet.

Throw Situations

2+4 Generic Throw

This throw will leave you face up, head towards Miguel and switch sides. Waking up here can be incredibly hazardous as you can eat a steel pedal flip for laying down, or since you are backwards, you can be caught by f+4,2 when trying to wake up normally by holding back. Hatchet and SAV df2 can be quickly input to neutralize your side rolls and f+4 will at best trade with you if it isn't used instantly.

Right Side Throw

Miguel puts you off axis and flips you over onto your back. You will be left with him standing to your character's left hip, directly on top of you. This is another disastrous place to be in as your defense is more compromised thanks to a shorter distance allowing him to use basically any low and any mid to immediately compromise you. Notably, he can easily stomp you in this position or force you to wake-up against his steel pedal.

df1+2 Command Throw

An interesting throw, although Miguel has no "true" throw game, this can sometimes confuse players unfamiliar with the matchup due to its animation being similar to his 2+4 grab in startup. While this move leaves you standing, the most CRITICAL thing to note, is that he has not only frame advantage (+4?) but a transition into SAV directly from stance. Meaning that almost all of the time this throw ends, you will be facing an advantaged Miguel ready to throw a hatchet or a mid. The only thing you want to do after this throw is DEFEND. The best you can hope for is trading with SAV b+1 when pressing buttons, the worst is a launch.

Wake Up

Below is a list of some moves that Miguel can use to hit grounded:

• fF,2

Can be used to catch people crouching on wake-up, or get almost no damage on someone staying down. Fuzzy guard on standing wake-up negate its usefulness.

• d+3+4

A heavily punishable steel-pedal, it still has long range and a CH launch property. Easy to roll.

• SAV db3

Miguel's version of Hatchet. This hits grounded, and will track rolls in both directions. It's his primary motivator to get opponents to wake up defending low.

• db3 (db3,4 will hit in certain situations)

A quick little nudge to push the opponent, keep them grounded, and go into SAV.

• d+3

A stomp move that only exists if you are grounded. If you roll and begin to stand, it will convert to his neutral d+3 in real time.

• b,df4

This slow, bizarre move will catch you for rolling or for standing up without defending low. Perhaps the ONLY situation where this move even begins to be useful, as it genuinely hurts to get hit by and if you are hit by it while standing up Miguel will get a huge frame advantage over you.

• SAV df2

Tracking rolls to both sides, launching people who wake up crouching, and flipping people over like a steel pedal for staying on the ground, this is the yin to Miguel's okizeme yang. If you wake up wrong against this move it's one very, very painful trip to the wall and most likely the last one you'll take if you're forced to guess against his wakeup. The risk on block is present for him, but many won't be afraid to take it for the reward.

• db4

A backwards moving low that CHs into a SAV df2. Relatively safe to throw out.

• d+4

Catches rolls but is rather limp for oki.

• SAV db4

A true snake edge, it catches side rolls, and deals a good chunk on hit, but is so slow and easy to get a death block punish on that even if the opponent stood up and ate the snake edge it would not be worth it, as it only gives a mini-combo.

Matchups

Miguel suffers greatly against any character that is able to space him out or take range 0 control against him. Although this sounds like a very vague definition for a character, it's actually something that can affect players of different playstyles.
Miguel will force you to either out-aggress him which can prove impossible if not properly set-up with frame advantage or frame traps, or he will force you to keep him at a range, depending on how you like to play. For some characters who have df4s which can act as mid-range pokes, that might be enough, but it is a low damage option that usually doesn't speak to the invasion the character is used to (A.K., Dragonuv, Bob etc.) despite being effective at disallowing Miguel to play his game.
Getting inside against him through any means, but being able to deal with b+1 and b+4 either through frame traps that are too fast for them to come out, or being able to cancel and wait for a response, also destroy him. His defensive panic moves are strong, but extremely predictable and even more punishable.
Characters who build their foundation on punishing and waiting are the absolute worst matchups he has, as much of his movelist is built on taking risks, like SAV db3 being -13 and being mixed up with a -17 move. A single block against SAV b+1,4 when you have meter is all it takes to kill him in some situations.

List of Confirmed Followups

So you don't get confused, here are some of the times Miguel can get guaranteed damage:

• b,f+1 guarantees SAV df2
  
• SAV 4 normal hit guarantees SAV df2
  
• CH db4 guarantees SAV df2
  
• CH SAV db3 guarantees SAV df2
  
• SAV 1,1 guarantees SAV df2, fF2,1 or d+4,1+2
  
• f+1+2 guarantees SAV 2
  
• 1,2,4 (the 4 hits) guarantees SAV 2
  
• (df1),2 CH guarantees SAV 2
  
• SAV b+3 guarantees SAV 2
  
• FC df+4 guarantees fF2,1 or an entire rage drive combo after WS+4
  
• SAV (b+1),2 guarantees fF2,1
  
• db+1 guarantees WS+4, d+4,1+2 or an entire rage drive combo after WS+4
  
• SAV db+4 guarantees WS4, d+4,1+2
  
• SAV 2 guarantees SAV df2 if the opponent is knocked down as close to the wall as possible without wallsplatting
  
• (df1,1),3 CH guarantees SAV df2 (?)
  

Round-Up

DO

• Keep Miguel at a range by using pokes such as df4 to shut him down
  
• Practice your punishing for moves that are -12
  
• Not panic
  
• Use your own offense to overwhelm his chance to defend
  

DON'T

• Allow Miguel to get in with linear, punishable, or fuzzy-guardable moves
  
• Panic
  
• Let him get away with moves that are visually confusing to punish like SAV 1,2,1 or b+4
  
• Press buttons when he's in SAV, unless you're jab/dickjabbing with extreme confidence
  

This is the first extensive guide or post I've made here. I'm still new to writing content for TEKKEN and to playing the game, including Miguel. I welcome criticisms, corrections, and opinions for how the guide can be improved in any way. This was an independently written guide so I apologize for inaccuracies or biases.
Contact me by PM if any of the visual aides linked fail to respond.